4h29 - Revision history

OCA at 11:35, 1 March 2024

OCA — Fri, 01 Mar 2024 11:35:27 GMT

←Older revision		Revision as of 11:35, 1 March 2024
Line 4:		Line 4:
	== Structural highlights ==		== Structural highlights ==
	<table><tr><td colspan='2'>[[4h29]] is a 2 chain structure with sequence from [https://en.wikipedia.org/wiki/Homo_sapiens Homo sapiens]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4H29 OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=4H29 FirstGlance]. <br>		<table><tr><td colspan='2'>[[4h29]] is a 2 chain structure with sequence from [https://en.wikipedia.org/wiki/Homo_sapiens Homo sapiens]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4H29 OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=4H29 FirstGlance]. <br>
-	</td></tr><tr id='ligand'><td class="sblockLbl"><b>[[Ligand\|Ligands:]]</b></td><td class="sblockDat" id="ligandDat"><scene name='pdbligand=K:POTASSIUM+ION'>K</scene></td></tr>	+	</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models\|Method:]]</b></td><td class="sblockDat" id="methodDat">X-ray diffraction, [[Resolution\|Resolution]] 1.991Å</td></tr>
		+	<tr id='ligand'><td class="sblockLbl"><b>[[Ligand\|Ligands:]]</b></td><td class="sblockDat" id="ligandDat"><scene name='pdbligand=K:POTASSIUM+ION'>K</scene></td></tr>
	<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=4h29 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4h29 OCA], [https://pdbe.org/4h29 PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=4h29 RCSB], [https://www.ebi.ac.uk/pdbsum/4h29 PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=4h29 ProSAT]</span></td></tr>		<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=4h29 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4h29 OCA], [https://pdbe.org/4h29 PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=4h29 RCSB], [https://www.ebi.ac.uk/pdbsum/4h29 PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=4h29 ProSAT]</span></td></tr>
	</table>		</table>
-	<div style="background-color:#fffaf0;">
-	== Publication Abstract from PubMed ==
-	The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive G-quartets and an uninterrupted run of six potassium ions in the central channel of the quadruplex. Analogy with previously reported promoter quadruplexes had initially suggested that in common with these a monomeric quadruplex was to be expected. The structure has a distorted G.C.G.C base quartet at one end and four flipped-out adenosine nucleosides at the other. The only loops in the structure are formed by the cytosine and by the three adenosines within the sequence, with all of the guanosines participating in G-quartet formation. Solution UV and circular dichroism data are in accord with a stable quadruple arrangement being formed. 1D NMR data, together with gel electrophoresis measurements, are consistent with a dimer being the dominant species in potassium solution. A single-chain intramolecular quadruplex has been straightforwardly constructed using molecular modeling, by means of a six-nucleotide sequence joining 3' and 5' ends of each strand in the dimer. A human genomic database search has revealed a number of sequences containing eight or more consecutive short G-tracts, suggesting that such intramolecular quadruplexes could be formed within the human genome.
-
-	Crystal Structure of a Promoter Sequence in the B-raf Gene Reveals an Intertwined Dimer Quadruplex.,Wei D, Todd AK, Zloh M, Gunaratnam M, Parkinson GN, Neidle S J Am Chem Soc. 2013 Dec 26;135(51):19319-29. doi: 10.1021/ja4101358. Epub 2013, Dec 11. PMID:24295054<ref>PMID:24295054</ref>
-
-	From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br>
-	</div>
-	<div class="pdbe-citations 4h29" style="background-color:#fffaf0;"></div>
-	== References ==
-	<references/>
	__TOC__		__TOC__
	</StructureSection>		</StructureSection>

OCA at 07:54, 3 November 2022

OCA — Thu, 03 Nov 2022 07:54:57 GMT

←Older revision		Revision as of 07:54, 3 November 2022
Line 3:		Line 3:
	<StructureSection load='4h29' size='340' side='right'caption='[[4h29]], [[Resolution\|resolution]] 1.99Å' scene=''>		<StructureSection load='4h29' size='340' side='right'caption='[[4h29]], [[Resolution\|resolution]] 1.99Å' scene=''>
	== Structural highlights ==		== Structural highlights ==
-	<table><tr><td colspan='2'>[[4h29]] is a 2 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4H29 OCA]. For a <b>guided tour on the structure components</b> use [~~http~~://~~oca~~.~~weizmann.ac.il/oca-docs~~/fgij/fg.htm?mol=4H29 FirstGlance]. <br>	+	<table><tr><td colspan='2'>[[4h29]] is a 2 chain structure with sequence from [https://en.wikipedia.org/wiki/Homo_sapiens Homo sapiens]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4H29 OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=4H29 FirstGlance]. <br>
-	</td></tr><tr id='ligand'><td class="sblockLbl"><b>[[Ligand\|Ligands:]]</b></td><td class="sblockDat"><scene name='pdbligand=K:POTASSIUM+ION'>K</scene></td></tr>	+	</td></tr><tr id='ligand'><td class="sblockLbl"><b>[[Ligand\|Ligands:]]</b></td><td class="sblockDat" id="ligandDat"><scene name='pdbligand=K:POTASSIUM+ION'>K</scene></td></tr>
-	<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[~~http~~://~~oca~~.~~weizmann.ac.il/oca-docs~~/fgij/fg.htm?mol=4h29 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4h29 OCA], [~~http~~://pdbe.org/4h29 PDBe], [~~http~~://www.rcsb.org/pdb/explore.do?structureId=4h29 RCSB], [~~http~~://www.ebi.ac.uk/pdbsum/4h29 PDBsum], [~~http~~://prosat.h-its.org/prosat/prosatexe?pdbcode=4h29 ProSAT]</span></td></tr>	+	<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=4h29 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4h29 OCA], [https://pdbe.org/4h29 PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=4h29 RCSB], [https://www.ebi.ac.uk/pdbsum/4h29 PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=4h29 ProSAT]</span></td></tr>
	</table>		</table>
	<div style="background-color:#fffaf0;">		<div style="background-color:#fffaf0;">
Line 20:		Line 20:
	__TOC__		__TOC__
	</StructureSection>		</StructureSection>
		+	[[Category: Homo sapiens]]
	[[Category: Large Structures]]		[[Category: Large Structures]]
-	[[Category: Neidle, S]]	+	[[Category: Neidle S]]
-	[[Category: Parkinson, G]]	+	[[Category: Parkinson G]]
-	[[Category: Wei, D]]	+	[[Category: Wei D]]
-	~~[[Category: B-raf quadruplex dna]]~~	+
-	~~[[Category: Dna~~]]	+

OCA at 07:48, 27 March 2019

OCA — Wed, 27 Mar 2019 07:48:02 GMT

←Older revision		Revision as of 07:48, 27 March 2019
Line 1:		Line 1:

	==B-raf dimer DNA quadruplex==		==B-raf dimer DNA quadruplex==
-	<StructureSection load='4h29' size='340' side='right' caption='[[4h29]], [[Resolution\|resolution]] 1.99Å' scene=''>	+	<StructureSection load='4h29' size='340' side='right'caption='[[4h29]], [[Resolution\|resolution]] 1.99Å' scene=''>
	== Structural highlights ==		== Structural highlights ==
	<table><tr><td colspan='2'>[[4h29]] is a 2 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4H29 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=4H29 FirstGlance]. <br>		<table><tr><td colspan='2'>[[4h29]] is a 2 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4H29 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=4H29 FirstGlance]. <br>
Line 20:		Line 20:
	__TOC__		__TOC__
	</StructureSection>		</StructureSection>
		+	[[Category: Large Structures]]
	[[Category: Neidle, S]]		[[Category: Neidle, S]]
	[[Category: Parkinson, G]]		[[Category: Parkinson, G]]

OCA at 07:13, 5 August 2016

OCA — Fri, 05 Aug 2016 07:13:31 GMT

←Older revision		Revision as of 07:13, 5 August 2016
Line 1:		Line 1:
		+
	==B-raf dimer DNA quadruplex==		==B-raf dimer DNA quadruplex==
	<StructureSection load='4h29' size='340' side='right' caption='[[4h29]], [[Resolution\|resolution]] 1.99Å' scene=''>		<StructureSection load='4h29' size='340' side='right' caption='[[4h29]], [[Resolution\|resolution]] 1.99Å' scene=''>
Line 4:		Line 5:
	<table><tr><td colspan='2'>[[4h29]] is a 2 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4H29 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=4H29 FirstGlance]. <br>		<table><tr><td colspan='2'>[[4h29]] is a 2 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4H29 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=4H29 FirstGlance]. <br>
	</td></tr><tr id='ligand'><td class="sblockLbl"><b>[[Ligand\|Ligands:]]</b></td><td class="sblockDat"><scene name='pdbligand=K:POTASSIUM+ION'>K</scene></td></tr>		</td></tr><tr id='ligand'><td class="sblockLbl"><b>[[Ligand\|Ligands:]]</b></td><td class="sblockDat"><scene name='pdbligand=K:POTASSIUM+ION'>K</scene></td></tr>
-	<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=4h29 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4h29 OCA], [http://www.rcsb.org/pdb/explore.do?structureId=4h29 RCSB], [http://www.ebi.ac.uk/pdbsum/4h29 PDBsum]</span></td></tr>	+	<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=4h29 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4h29 OCA], [http://pdbe.org/4h29 PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=4h29 RCSB], [http://www.ebi.ac.uk/pdbsum/4h29 PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=4h29 ProSAT]</span></td></tr>
	</table>		</table>
	<div style="background-color:#fffaf0;">		<div style="background-color:#fffaf0;">
Line 14:		Line 15:
	From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br>		From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br>
	</div>		</div>
		+	<div class="pdbe-citations 4h29" style="background-color:#fffaf0;"></div>
	== References ==		== References ==
	<references/>		<references/>

OCA at 18:18, 21 December 2014

OCA — Sun, 21 Dec 2014 18:18:14 GMT

←Older revision		Revision as of 18:18, 21 December 2014
Line 1:		Line 1:
-	~~{{STRUCTURE_4h29~~\| ~~PDB~~=4h29 \| ~~SCENE~~= }}	+	==B-raf dimer DNA quadruplex==
-	===B-~~raf dimer DNA quadruplex~~===	+	<StructureSection load='4h29' size='340' side='right' caption='[[4h29]], [[Resolution\|resolution]] 1.99Å' scene=''>
-	~~{{ABSTRACT_PUBMED_24295054}}~~	+	== Structural highlights ==
		+	<table><tr><td colspan='2'>[[4h29]] is a 2 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4H29 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=4H29 FirstGlance]. <br>
		+	</td></tr><tr id='ligand'><td class="sblockLbl"><b>[[Ligand\|Ligands:]]</b></td><td class="sblockDat"><scene name='pdbligand=K:POTASSIUM+ION'>K</scene></td></tr>
		+	<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=4h29 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4h29 OCA], [http://www.rcsb.org/pdb/explore.do?structureId=4h29 RCSB], [http://www.ebi.ac.uk/pdbsum/4h29 PDBsum]</span></td></tr>
		+	</table>
		+	<div style="background-color:#fffaf0;">
		+	== Publication Abstract from PubMed ==
		+	The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive G-quartets and an uninterrupted run of six potassium ions in the central channel of the quadruplex. Analogy with previously reported promoter quadruplexes had initially suggested that in common with these a monomeric quadruplex was to be expected. The structure has a distorted G.C.G.C base quartet at one end and four flipped-out adenosine nucleosides at the other. The only loops in the structure are formed by the cytosine and by the three adenosines within the sequence, with all of the guanosines participating in G-quartet formation. Solution UV and circular dichroism data are in accord with a stable quadruple arrangement being formed. 1D NMR data, together with gel electrophoresis measurements, are consistent with a dimer being the dominant species in potassium solution. A single-chain intramolecular quadruplex has been straightforwardly constructed using molecular modeling, by means of a six-nucleotide sequence joining 3' and 5' ends of each strand in the dimer. A human genomic database search has revealed a number of sequences containing eight or more consecutive short G-tracts, suggesting that such intramolecular quadruplexes could be formed within the human genome.

-	~~==About this~~ Structure==	+	Crystal Structure of a Promoter Sequence in the B-raf Gene Reveals an Intertwined Dimer Quadruplex.,Wei D, Todd AK, Zloh M, Gunaratnam M, Parkinson GN, Neidle S J Am Chem Soc. 2013 Dec 26;135(51):19319-29. doi: 10.1021/ja4101358. Epub 2013, Dec 11. PMID:24295054<ref>PMID:24295054</ref>
-	~~[[4h29]] is~~ a ~~2 chain structure~~. ~~Full crystallographic information is available from [http~~:~~//oca~~.~~weizmann~~.~~ac.il~~/~~oca-bin/ocashort?id=4H29 OCA]~~.	+

-	==~~Reference~~==	+	From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br>
-	~~<ref group="xtra">PMID:024295054</ref>~~<references ~~group="xtra"~~/><~~references~~/>	+	</div>
-	[[Category: Neidle, S.]]	+	== References ==
-	[[Category: Parkinson, G.]]	+	<references/>
-	[[Category: Wei, D.]]	+	__TOC__
		+	</StructureSection>
		+	[[Category: Neidle, S]]
		+	[[Category: Parkinson, G]]
		+	[[Category: Wei, D]]
	[[Category: B-raf quadruplex dna]]		[[Category: B-raf quadruplex dna]]
	[[Category: Dna]]		[[Category: Dna]]

OCA at 08:23, 8 January 2014

OCA — Wed, 08 Jan 2014 08:23:07 GMT

←Older revision		Revision as of 08:23, 8 January 2014
Line 1:		Line 1:
	{{STRUCTURE_4h29\| PDB=4h29 \| SCENE= }}		{{STRUCTURE_4h29\| PDB=4h29 \| SCENE= }}
	===B-raf dimer DNA quadruplex===		===B-raf dimer DNA quadruplex===
		+	{{ABSTRACT_PUBMED_24295054}}

	==About this Structure==		==About this Structure==
	[[4h29]] is a 2 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4H29 OCA].		[[4h29]] is a 2 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4H29 OCA].
		+
		+	==Reference==
		+	<ref group="xtra">PMID:024295054</ref><references group="xtra"/><references/>
	[[Category: Neidle, S.]]		[[Category: Neidle, S.]]
	[[Category: Parkinson, G.]]		[[Category: Parkinson, G.]]

OCA at 05:17, 1 August 2013

OCA — Thu, 01 Aug 2013 05:17:22 GMT

←Older revision		Revision as of 05:17, 1 August 2013
Line 1:		Line 1:
-	~~'''Unreleased structure'''~~	+	{{STRUCTURE_4h29\| PDB=4h29 \| SCENE= }}
		+	===B-raf dimer DNA quadruplex===

-	~~The entry~~ 4h29 is ~~ON HOLD until Paper Publication~~	+	==About this Structure==
-		+	[[4h29]] is a 2 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4H29 OCA].
-	~~Authors~~: ~~Wei~~, D., Parkinson, G., ~~Neidle, S~~.	+	[[Category: Neidle, S.]]
-		+	[[Category: Parkinson, G.]]
-	~~Description~~: B-raf ~~dimer DNA~~ quadruplex	+	[[Category: Wei, D.]]
		+	[[Category: B-raf quadruplex dna]]
		+	[[Category: Dna]]

OCA at 07:07, 24 October 2012

OCA — Wed, 24 Oct 2012 07:07:35 GMT

←Older revision		Revision as of 07:07, 24 October 2012
Line 1:		Line 1:
	'''Unreleased structure'''		'''Unreleased structure'''

-	The entry 4h29 is ON HOLD	+	The entry 4h29 is ON HOLD until Paper Publication

	Authors: Wei, D., Parkinson, G., Neidle, S.		Authors: Wei, D., Parkinson, G., Neidle, S.

	Description: B-raf dimer DNA quadruplex		Description: B-raf dimer DNA quadruplex

OCA at 05:46, 3 October 2012

OCA — Wed, 03 Oct 2012 05:46:48 GMT

←Older revision		Revision as of 05:46, 3 October 2012
Line 3:		Line 3:
	The entry 4h29 is ON HOLD		The entry 4h29 is ON HOLD

-	Authors: Wei,D. , Parkinson,G., Neidle,S.	+	Authors: Wei, D., Parkinson, G., Neidle, S.

	Description: B-raf dimer DNA quadruplex		Description: B-raf dimer DNA quadruplex

OCA: Protected "4h29" [edit=sysop:move=sysop]

OCA — Wed, 19 Sep 2012 06:58:17 GMT

Protected "4h29" [edit=sysop:move=sysop]

←Older revision

Revision as of 06:58, 19 September 2012