5ds9 - Revision history

OCA at 21:57, 28 June 2023

OCA — Wed, 28 Jun 2023 21:57:30 GMT

←Older revision		Revision as of 21:57, 28 June 2023
Line 3:		Line 3:
	<StructureSection load='5ds9' size='340' side='right'caption='[[5ds9]], [[Resolution\|resolution]] 2.56Å' scene=''>		<StructureSection load='5ds9' size='340' side='right'caption='[[5ds9]], [[Resolution\|resolution]] 2.56Å' scene=''>
	== Structural highlights ==		== Structural highlights ==
-	<table><tr><td colspan='2'>[[5ds9]] is a 4 chain structure with sequence from [~~http~~://en.wikipedia.org/wiki/~~Ecoli Ecoli~~]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5DS9 OCA]. For a <b>guided tour on the structure components</b> use [~~http~~://proteopedia.org/fgij/fg.htm?mol=5DS9 FirstGlance]. <br>	+	<table><tr><td colspan='2'>[[5ds9]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Escherichia_coli_K-12 Escherichia coli K-12] and [https://en.wikipedia.org/wiki/Synthetic_construct Synthetic construct]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5DS9 OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=5DS9 FirstGlance]. <br>
-	</td></tr><tr id='~~related~~'><td class="sblockLbl"><b>[[~~Related_structure~~\|~~Related~~:]]</b></td><td class="sblockDat"~~>[[5dtd\|5dtd]], [[5e3l\|5e3l]], [[5e3n\|5e3n]], [[5e3o\|5e3o]], [[5e3m\|5e3m]]</td></tr>~~	+	</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models\|Method:]]</b></td><td class="sblockDat" id="methodDat">X-ray diffraction, [[Resolution\|Resolution]] 2.561Å</td></tr>
-	~~<tr~~ id~~='gene'><td class~~="~~sblockLbl~~">~~<b>~~[[~~Gene~~\|~~Gene:~~]]~~</b></td><td class="sblockDat">fis, b3261, JW3229 ([http://www~~.~~ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info~~&~~srchmode=5&id=83333 ECOLI])~~</td></tr>	+	<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=5ds9 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5ds9 OCA], [https://pdbe.org/5ds9 PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=5ds9 RCSB], [https://www.ebi.ac.uk/pdbsum/5ds9 PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=5ds9 ProSAT]</span></td></tr>
-	<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[~~http~~://proteopedia.org/fgij/fg.htm?mol=5ds9 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5ds9 OCA], [~~http~~://pdbe.org/5ds9 PDBe], [~~http~~://www.rcsb.org/pdb/explore.do?structureId=5ds9 RCSB], [~~http~~://www.ebi.ac.uk/pdbsum/5ds9 PDBsum], [~~http~~://prosat.h-its.org/prosat/prosatexe?pdbcode=5ds9 ProSAT]</span></td></tr>	+
	</table>		</table>
	== Function ==		== Function ==
-	[~~[http~~://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI]] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref>	+	[https://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref>
	<div style="background-color:#fffaf0;">		<div style="background-color:#fffaf0;">
	== Publication Abstract from PubMed ==		== Publication Abstract from PubMed ==
Line 26:		Line 25:
	__TOC__		__TOC__
	</StructureSection>		</StructureSection>
-	[[Category: ~~Ecoli~~]]	+	[[Category: Escherichia coli K-12]]
	[[Category: Large Structures]]		[[Category: Large Structures]]
-	[[Category: ~~Cascio, D~~]]	+	[[Category: Synthetic construct]]
-	[[Category: ~~Hancock, S P~~]]	+	[[Category: Cascio D]]
-	[[Category: ~~Johnson, R C~~]]	+	[[Category: Hancock SP]]
-	[[Category: ~~Dna bending]]~~	+	[[Category: Johnson RC]]
-	~~[[Category: Dna binding protein-dna complex]]~~	+
-	~~[[Category: Hth domain]]~~	+
-	~~[[Category: Indirect recognition]]~~	+
-	~~[[Category: Protein-dna complex~~]]	+

OCA at 08:04, 15 April 2020

OCA — Wed, 15 Apr 2020 08:04:04 GMT

←Older revision		Revision as of 08:04, 15 April 2020
Line 1:		Line 1:

	==Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)==		==Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)==
-	<StructureSection load='5ds9' size='340' side='right' caption='[[5ds9]], [[Resolution\|resolution]] 2.56Å' scene=''>	+	<StructureSection load='5ds9' size='340' side='right'caption='[[5ds9]], [[Resolution\|resolution]] 2.56Å' scene=''>
	== Structural highlights ==		== Structural highlights ==
-	<table><tr><td colspan='2'>[[5ds9]] is a 4 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5DS9 OCA]. For a <b>guided tour on the structure components</b> use [http://~~oca~~.~~weizmann.ac.il/oca-docs~~/fgij/fg.htm?mol=5DS9 FirstGlance]. <br>	+	<table><tr><td colspan='2'>[[5ds9]] is a 4 chain structure with sequence from [http://en.wikipedia.org/wiki/Ecoli Ecoli]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5DS9 OCA]. For a <b>guided tour on the structure components</b> use [http://proteopedia.org/fgij/fg.htm?mol=5DS9 FirstGlance]. <br>
	</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure\|Related:]]</b></td><td class="sblockDat">[[5dtd\|5dtd]], [[5e3l\|5e3l]], [[5e3n\|5e3n]], [[5e3o\|5e3o]], [[5e3m\|5e3m]]</td></tr>		</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure\|Related:]]</b></td><td class="sblockDat">[[5dtd\|5dtd]], [[5e3l\|5e3l]], [[5e3n\|5e3n]], [[5e3o\|5e3o]], [[5e3m\|5e3m]]</td></tr>
-	<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://~~oca~~.~~weizmann.ac.il/oca-docs~~/fgij/fg.htm?mol=5ds9 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5ds9 OCA], [http://pdbe.org/5ds9 PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5ds9 RCSB], [http://www.ebi.ac.uk/pdbsum/5ds9 PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=5ds9 ProSAT]</span></td></tr>	+	<tr id='gene'><td class="sblockLbl"><b>[[Gene\|Gene:]]</b></td><td class="sblockDat">fis, b3261, JW3229 ([http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&srchmode=5&id=83333 ECOLI])</td></tr>
		+	<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://proteopedia.org/fgij/fg.htm?mol=5ds9 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5ds9 OCA], [http://pdbe.org/5ds9 PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5ds9 RCSB], [http://www.ebi.ac.uk/pdbsum/5ds9 PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=5ds9 ProSAT]</span></td></tr>
	</table>		</table>
	== Function ==		== Function ==
Line 18:		Line 19:
	</div>		</div>
	<div class="pdbe-citations 5ds9" style="background-color:#fffaf0;"></div>		<div class="pdbe-citations 5ds9" style="background-color:#fffaf0;"></div>
		+
		+	==See Also==
		+	*[[FIS protein\|FIS protein]]
	== References ==		== References ==
	<references/>		<references/>
	__TOC__		__TOC__
	</StructureSection>		</StructureSection>
		+	[[Category: Ecoli]]
		+	[[Category: Large Structures]]
	[[Category: Cascio, D]]		[[Category: Cascio, D]]
	[[Category: Hancock, S P]]		[[Category: Hancock, S P]]

OCA at 15:37, 27 July 2016

OCA — Wed, 27 Jul 2016 15:37:53 GMT

←Older revision		Revision as of 15:37, 27 July 2016
Line 1:		Line 1:
-	'''Unreleased structure'''

-	~~The entry~~ 5ds9 is ~~ON HOLD~~ ~~until Paper~~ Publication	+	==Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)==
		+	<StructureSection load='5ds9' size='340' side='right' caption='[[5ds9]], [[Resolution\|resolution]] 2.56Å' scene=''>
		+	== Structural highlights ==
		+	<table><tr><td colspan='2'>[[5ds9]] is a 4 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5DS9 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5DS9 FirstGlance]. <br>
		+	</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure\|Related:]]</b></td><td class="sblockDat">[[5dtd\|5dtd]], [[5e3l\|5e3l]], [[5e3n\|5e3n]], [[5e3o\|5e3o]], [[5e3m\|5e3m]]</td></tr>
		+	<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5ds9 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5ds9 OCA], [http://pdbe.org/5ds9 PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5ds9 RCSB], [http://www.ebi.ac.uk/pdbsum/5ds9 PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=5ds9 ProSAT]</span></td></tr>
		+	</table>
		+	== Function ==
		+	[[http://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI]] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref>
		+	<div style="background-color:#fffaf0;">
		+	== Publication Abstract from PubMed ==
		+	The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequences in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. The affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.

-	~~Authors:~~ Hancock, S~~.P.~~, Cascio, D., Johnson~~, R~~.C.	+	DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.,Hancock SP, Stella S, Cascio D, Johnson RC PLoS One. 2016 Mar 9;11(3):e0150189. doi: 10.1371/journal.pone.0150189., eCollection 2016. PMID:26959646<ref>PMID:26959646</ref>

-	~~Description: Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)~~	+	From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br>
-	~~[[Category: Unreleased Structures]]~~	+	</div>
-	~~[[Category: Hancock~~, S.~~P]]~~	+	<div class="pdbe-citations 5ds9" style="background-color:#fffaf0;"></div>
-	~~[[Category~~: ~~Johnson, R.C]]~~	+	== References ==
		+	<references/>
		+	__TOC__
		+	</StructureSection>
	[[Category: Cascio, D]]		[[Category: Cascio, D]]
		+	[[Category: Hancock, S P]]
		+	[[Category: Johnson, R C]]
		+	[[Category: Dna bending]]
		+	[[Category: Dna binding protein-dna complex]]
		+	[[Category: Hth domain]]
		+	[[Category: Indirect recognition]]
		+	[[Category: Protein-dna complex]]

OCA at 02:08, 1 December 2015

OCA — Tue, 01 Dec 2015 02:08:07 GMT

←Older revision		Revision as of 02:08, 1 December 2015
Line 1:		Line 1:
	'''Unreleased structure'''		'''Unreleased structure'''

-	The entry 5ds9 is ON HOLD	+	The entry 5ds9 is ON HOLD until Paper Publication

	Authors: Hancock, S.P., Cascio, D., Johnson, R.C.		Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

OCA at 02:38, 16 October 2015

OCA — Fri, 16 Oct 2015 02:38:35 GMT

←Older revision		Revision as of 02:38, 16 October 2015
Line 1:		Line 1:
	'''Unreleased structure'''		'''Unreleased structure'''

-	The entry 5ds9 is ON HOLD ~~until sometime in the future~~	+	The entry 5ds9 is ON HOLD

	Authors: Hancock, S.P., Cascio, D., Johnson, R.C.		Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

OCA at 12:32, 7 October 2015

OCA — Wed, 07 Oct 2015 12:32:49 GMT

←Older revision		Revision as of 12:32, 7 October 2015
Line 1:		Line 1:
	'''Unreleased structure'''		'''Unreleased structure'''

-	The entry 5ds9 is ON HOLD until ~~Paper Publication~~	+	The entry 5ds9 is ON HOLD until sometime in the future

	Authors: Hancock, S.P., Cascio, D., Johnson, R.C.		Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

OCA: Protected "5ds9" [edit=sysop:move=sysop]

OCA — Wed, 30 Sep 2015 13:27:14 GMT

Protected "5ds9" [edit=sysop:move=sysop]

←Older revision

Revision as of 13:27, 30 September 2015

OCA: New page: '''Unreleased structure''' The entry 5ds9 is ON HOLD until Paper Publication Authors: Hancock, S.P., Cascio, D., Johnson, R.C. Description: Crystal structure of Fis bound to 27bp DNA F...

OCA — Wed, 30 Sep 2015 13:27:13 GMT

New page: '''Unreleased structure''' The entry 5ds9 is ON HOLD until Paper Publication Authors: Hancock, S.P., Cascio, D., Johnson, R.C. Description: Crystal structure of Fis bound to 27bp DNA F...

New page

'''Unreleased structure'''

The entry 5ds9 is ON HOLD until Paper Publication

Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)
[[Category: Unreleased Structures]]
[[Category: Hancock, S.P]]
[[Category: Johnson, R.C]]
[[Category: Cascio, D]]