5j05 - Revision history

OCA at 10:40, 6 September 2023

OCA — Wed, 06 Sep 2023 10:40:37 GMT

←Older revision		Revision as of 10:40, 6 September 2023
Line 1:		Line 1:

	==DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium==		==DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium==
-	<StructureSection load='5j05' size='340' side='right'caption='[[5j05~~]], [[NMR_Ensembles_of_Models \| 10 NMR models~~]]' scene=''>	+	<StructureSection load='5j05' size='340' side='right'caption='[[5j05]]' scene=''>
	== Structural highlights ==		== Structural highlights ==
-	<table><tr><td colspan='2'>[[5j05]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5J05 OCA]. For a <b>guided tour on the structure components</b> use [~~http~~://~~oca~~.~~weizmann.ac.il/oca-docs~~/fgij/fg.htm?mol=5J05 FirstGlance]. <br>	+	<table><tr><td colspan='2'>[[5j05]] is a 1 chain structure with sequence from [https://en.wikipedia.org/wiki/Synthetic_construct Synthetic construct]. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5J05 OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=5J05 FirstGlance]. <br>
-	</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[~~http~~://~~oca~~.~~weizmann.ac.il/oca-docs~~/fgij/fg.htm?mol=5j05 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5j05 OCA], [~~http~~://pdbe.org/5j05 PDBe], [~~http~~://www.rcsb.org/pdb/explore.do?structureId=5j05 RCSB], [~~http~~://www.ebi.ac.uk/pdbsum/5j05 PDBsum], [~~http~~://prosat.h-its.org/prosat/prosatexe?pdbcode=5j05 ProSAT]</span></td></tr>	+	</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models\|Method:]]</b></td><td class="sblockDat" id="methodDat">Solution NMR</td></tr>
		+	<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=5j05 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5j05 OCA], [https://pdbe.org/5j05 PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=5j05 RCSB], [https://www.ebi.ac.uk/pdbsum/5j05 PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=5j05 ProSAT]</span></td></tr>
	</table>		</table>
	<div style="background-color:#fffaf0;">		<div style="background-color:#fffaf0;">
Line 20:		Line 21:
	</StructureSection>		</StructureSection>
	[[Category: Large Structures]]		[[Category: Large Structures]]
-	[[Category: ~~Dvorkin, S A~~]]	+	[[Category: Synthetic construct]]
-	[[Category: ~~Karsisiotis, A I~~]]	+	[[Category: Dvorkin SA]]
-	[[Category: ~~Silva, M Webba da~~]]	+	[[Category: Karsisiotis AI]]
-	[[Category: ~~Dna]]~~	+	[[Category: Webba da Silva M]]
-	~~[[Category: Structure from molmol~~]]	+

OCA at 13:03, 10 May 2019

OCA — Fri, 10 May 2019 13:03:57 GMT

←Older revision		Revision as of 13:03, 10 May 2019
Line 1:		Line 1:

	==DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium==		==DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium==
-	<StructureSection load='5j05' size='340' side='right' caption='[[5j05]], [[NMR_Ensembles_of_Models \| 10 NMR models]]' scene=''>	+	<StructureSection load='5j05' size='340' side='right'caption='[[5j05]], [[NMR_Ensembles_of_Models \| 10 NMR models]]' scene=''>
	== Structural highlights ==		== Structural highlights ==
	<table><tr><td colspan='2'>[[5j05]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5J05 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5J05 FirstGlance]. <br>		<table><tr><td colspan='2'>[[5j05]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5J05 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5J05 FirstGlance]. <br>
Line 19:		Line 19:
	__TOC__		__TOC__
	</StructureSection>		</StructureSection>
		+	[[Category: Large Structures]]
	[[Category: Dvorkin, S A]]		[[Category: Dvorkin, S A]]
	[[Category: Karsisiotis, A I]]		[[Category: Karsisiotis, A I]]

OCA at 08:21, 10 October 2018

OCA — Wed, 10 Oct 2018 08:21:08 GMT

←Older revision		Revision as of 08:21, 10 October 2018
Line 6:		Line 6:
	</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5j05 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5j05 OCA], [http://pdbe.org/5j05 PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5j05 RCSB], [http://www.ebi.ac.uk/pdbsum/5j05 PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=5j05 ProSAT]</span></td></tr>		</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5j05 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5j05 OCA], [http://pdbe.org/5j05 PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5j05 RCSB], [http://www.ebi.ac.uk/pdbsum/5j05 PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=5j05 ProSAT]</span></td></tr>
	</table>		</table>
		+	<div style="background-color:#fffaf0;">
		+	== Publication Abstract from PubMed ==
		+	The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications.
		+
		+	Encoding canonical DNA quadruplex structure.,Dvorkin SA, Karsisiotis AI, Webba da Silva M Sci Adv. 2018 Aug 31;4(8):eaat3007. doi: 10.1126/sciadv.aat3007. eCollection 2018, Aug. PMID:30182059<ref>PMID:30182059</ref>
		+
		+	From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br>
		+	</div>
		+	<div class="pdbe-citations 5j05" style="background-color:#fffaf0;"></div>
		+	== References ==
		+	<references/>
	__TOC__		__TOC__
	</StructureSection>		</StructureSection>

OCA at 13:25, 5 April 2017

OCA — Wed, 05 Apr 2017 13:25:48 GMT

←Older revision		Revision as of 13:25, 5 April 2017
Line 1:		Line 1:
-	'''Unreleased structure'''

-	~~The entry~~ 5j05 is ~~ON HOLD until Paper Publication~~	+	==DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium==
-		+	<StructureSection load='5j05' size='340' side='right' caption='[[5j05]], [[NMR_Ensembles_of_Models \| 10 NMR models]]' scene=''>
-	~~Authors~~:	+	== Structural highlights ==
-		+	<table><tr><td colspan='2'>[[5j05]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5J05 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5J05 FirstGlance]. <br>
-	~~Description~~:	+	</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5j05 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5j05 OCA], [http://pdbe.org/5j05 PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5j05 RCSB], [http://www.ebi.ac.uk/pdbsum/5j05 PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=5j05 ProSAT]</span></td></tr>
-	[[Category: ~~Unreleased Structures~~]]	+	</table>
		+	__TOC__
		+	</StructureSection>
		+	[[Category: Dvorkin, S A]]
		+	[[Category: Karsisiotis, A I]]
		+	[[Category: Silva, M Webba da]]
		+	[[Category: Dna]]
		+	[[Category: Structure from molmol]]

OCA at 13:00, 1 June 2016

OCA — Wed, 01 Jun 2016 13:00:10 GMT

←Older revision		Revision as of 13:00, 1 June 2016
Line 1:		Line 1:
	'''Unreleased structure'''		'''Unreleased structure'''

-	The entry 5j05 is ON HOLD	+	The entry 5j05 is ON HOLD until Paper Publication

	Authors:		Authors:

OCA at 14:55, 15 May 2016

OCA — Sun, 15 May 2016 14:55:34 GMT

←Older revision		Revision as of 14:55, 15 May 2016
Line 3:		Line 3:
	The entry 5j05 is ON HOLD		The entry 5j05 is ON HOLD

-	Authors: ~~Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M.~~	+	Authors:

	Description:		Description:
	[[Category: Unreleased Structures]]		[[Category: Unreleased Structures]]
-	[[Category: Dvorkin, S.A]]
-	[[Category: Karsisiotis, A.I]]
-	[[Category: Webba Da Silva, M]]

OCA: Protected "5j05" [edit=sysop:move=sysop]

OCA — Wed, 11 May 2016 01:14:38 GMT

Protected "5j05" [edit=sysop:move=sysop]

←Older revision

Revision as of 01:14, 11 May 2016

OCA: New page: '''Unreleased structure''' The entry 5j05 is ON HOLD Authors: Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M. Description: Category: Unreleased Structures [[Category: Dvorkin...

OCA — Wed, 11 May 2016 01:14:36 GMT

New page: '''Unreleased structure''' The entry 5j05 is ON HOLD Authors: Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M. Description: Category: Unreleased Structures [[Category: Dvorkin...

New page

'''Unreleased structure'''

The entry 5j05 is ON HOLD

Authors: Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M.

Description:
[[Category: Unreleased Structures]]
[[Category: Dvorkin, S.A]]
[[Category: Karsisiotis, A.I]]
[[Category: Webba Da Silva, M]]