6l92 - Revision history

OCA at 10:53, 14 June 2023

OCA — Wed, 14 Jun 2023 10:53:53 GMT

←Older revision		Revision as of 10:53, 14 June 2023
Line 1:		Line 1:

	==A basket type G-quadruplex in WNT DNA promoter==		==A basket type G-quadruplex in WNT DNA promoter==
-	<StructureSection load='6l92' size='340' side='right'caption='[[6l92~~]], [[NMR_Ensembles_of_Models \| 10 NMR models~~]]' scene=''>	+	<StructureSection load='6l92' size='340' side='right'caption='[[6l92]]' scene=''>
	== Structural highlights ==		== Structural highlights ==
-	<table><tr><td colspan='2'>[[6l92]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=6L92 OCA]. For a <b>guided tour on the structure components</b> use [~~http~~://~~oca~~.~~weizmann.ac.il/oca-docs~~/fgij/fg.htm?mol=6L92 FirstGlance]. <br>	+	<table><tr><td colspan='2'>[[6l92]] is a 1 chain structure with sequence from [https://en.wikipedia.org/wiki/Homo_sapiens Homo sapiens]. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=6L92 OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=6L92 FirstGlance]. <br>
-	</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[~~http~~://~~oca~~.~~weizmann.ac.il/oca-docs~~/fgij/fg.htm?mol=6l92 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=6l92 OCA], [~~http~~://pdbe.org/6l92 PDBe], [~~http~~://www.rcsb.org/pdb/explore.do?structureId=6l92 RCSB], [~~http~~://www.ebi.ac.uk/pdbsum/6l92 PDBsum], [~~http~~://prosat.h-its.org/prosat/prosatexe?pdbcode=6l92 ProSAT]</span></td></tr>	+	</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=6l92 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=6l92 OCA], [https://pdbe.org/6l92 PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=6l92 RCSB], [https://www.ebi.ac.uk/pdbsum/6l92 PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=6l92 ProSAT]</span></td></tr>
	</table>		</table>
	<div style="background-color:#fffaf0;">		<div style="background-color:#fffaf0;">
Line 19:		Line 19:
	__TOC__		__TOC__
	</StructureSection>		</StructureSection>
		+	[[Category: Homo sapiens]]
	[[Category: Large Structures]]		[[Category: Large Structures]]
-	[[Category: Chang~~, T C~~]]	+	[[Category: Chang TC]]
-	[[Category: Chu~~, I T~~]]	+	[[Category: Chu IT]]
-	[[Category: Li~~, M H~~]]	+	[[Category: Li MH]]
-	[[Category: Phan~~, A T~~]]	+	[[Category: Phan AT]]
-	[[Category: Wang~~, Z F~~]]	+	[[Category: Wang ZF]]
-	[[Category: Winnerdy~~, F R]]~~	+	[[Category: Winnerdy FR]]
-	~~[[Category: Dna]]~~	+
-	~~[[Category: Dna promoter]]~~	+
-	~~[[Category: G-quadruplex]]~~	+
-	~~[[Category: Wnt~~]]	+

OCA at 16:12, 29 January 2020

OCA — Wed, 29 Jan 2020 16:12:07 GMT

←Older revision		Revision as of 16:12, 29 January 2020
Line 6:		Line 6:
	</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=6l92 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=6l92 OCA], [http://pdbe.org/6l92 PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=6l92 RCSB], [http://www.ebi.ac.uk/pdbsum/6l92 PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=6l92 ProSAT]</span></td></tr>		</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=6l92 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=6l92 OCA], [http://pdbe.org/6l92 PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=6l92 RCSB], [http://www.ebi.ac.uk/pdbsum/6l92 PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=6l92 ProSAT]</span></td></tr>
	</table>		</table>
		+	<div style="background-color:#fffaf0;">
		+	== Publication Abstract from PubMed ==
		+	Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.
		+
		+	Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.,Wang ZF, Li MH, Chu IT, Winnerdy FR, Phan AT, Chang TC Nucleic Acids Res. 2020 Jan 8. pii: 5698138. doi: 10.1093/nar/gkz1207. PMID:31912153<ref>PMID:31912153</ref>
		+
		+	From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br>
		+	</div>
		+	<div class="pdbe-citations 6l92" style="background-color:#fffaf0;"></div>
		+	== References ==
		+	<references/>
	__TOC__		__TOC__
	</StructureSection>		</StructureSection>

OCA at 15:06, 11 December 2019

OCA — Wed, 11 Dec 2019 15:06:43 GMT

←Older revision		Revision as of 15:06, 11 December 2019
Line 1:		Line 1:
-	'''Unreleased structure'''

-	~~The entry~~ 6l92 ~~is ON HOLD~~	+	==A basket type G-quadruplex in WNT DNA promoter==
-		+	<StructureSection load='6l92' size='340' side='right'caption='[[6l92]], [[NMR_Ensembles_of_Models \| 10 NMR models]]' scene=''>
-	~~Authors~~: ~~Wang, Z~~.F.~~, Li, M~~.H., ~~Chu, I~~.T., ~~Winnerdy~~, F.R., ~~Phan, A~~.T., ~~Chang, T~~.C.	+	== Structural highlights ==
-		+	<table><tr><td colspan='2'>[[6l92]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=6L92 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=6L92 FirstGlance]. <br>
-	~~Description: A basket type G-quadruplex in WNT DNA promoter~~	+	</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=6l92 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=6l92 OCA], [http://pdbe.org/6l92 PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=6l92 RCSB], [http://www.ebi.ac.uk/pdbsum/6l92 PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=6l92 ProSAT]</span></td></tr>
-	[[Category: ~~Unreleased~~ Structures]]	+	</table>
-	[[Category: Chu, I.T]]	+	__TOC__
-	[[Category: ~~Wang~~, ~~Z.F~~]]	+	</StructureSection>
-	[[Category: Phan, A.T]]	+	[[Category: Large Structures]]
-	[[Category: Winnerdy, F.R]]	+	[[Category: Chang, T C]]
-	[[Category: ~~Li, M.H~~]]	+	[[Category: Chu, I T]]
-	[[Category: ~~Chang, T.C~~]]	+	[[Category: Li, M H]]
		+	[[Category: Phan, A T]]
		+	[[Category: Wang, Z F]]
		+	[[Category: Winnerdy, F R]]
		+	[[Category: Dna]]
		+	[[Category: Dna promoter]]
		+	[[Category: G-quadruplex]]
		+	[[Category: Wnt]]

OCA at 06:14, 4 December 2019

OCA — Wed, 04 Dec 2019 06:14:41 GMT

←Older revision		Revision as of 06:14, 4 December 2019
Line 5:		Line 5:
	Authors: Wang, Z.F., Li, M.H., Chu, I.T., Winnerdy, F.R., Phan, A.T., Chang, T.C.		Authors: Wang, Z.F., Li, M.H., Chu, I.T., Winnerdy, F.R., Phan, A.T., Chang, T.C.

-	Description: A basket ~~form of~~ G-quadruplex	+	Description: A basket type G-quadruplex in WNT DNA promoter
	[[Category: Unreleased Structures]]		[[Category: Unreleased Structures]]
	[[Category: Chu, I.T]]		[[Category: Chu, I.T]]

OCA: Protected "6l92" [edit=sysop:move=sysop]

OCA — Wed, 13 Nov 2019 09:19:03 GMT

Protected "6l92" [edit=sysop:move=sysop]

←Older revision

Revision as of 09:19, 13 November 2019

OCA: New page: '''Unreleased structure''' The entry 6l92 is ON HOLD Authors: Wang, Z.F., Li, M.H., Chu, I.T., Winnerdy, F.R., Phan, A.T., Chang, T.C. Description: A basket form of G-quadruplex [[Cate...

OCA — Wed, 13 Nov 2019 09:19:01 GMT

New page: '''Unreleased structure''' The entry 6l92 is ON HOLD Authors: Wang, Z.F., Li, M.H., Chu, I.T., Winnerdy, F.R., Phan, A.T., Chang, T.C. Description: A basket form of G-quadruplex [[Cate...

New page

'''Unreleased structure'''

The entry 6l92 is ON HOLD

Authors: Wang, Z.F., Li, M.H., Chu, I.T., Winnerdy, F.R., Phan, A.T., Chang, T.C.

Description: A basket form of G-quadruplex
[[Category: Unreleased Structures]]
[[Category: Chu, I.T]]
[[Category: Wang, Z.F]]
[[Category: Phan, A.T]]
[[Category: Winnerdy, F.R]]
[[Category: Li, M.H]]
[[Category: Chang, T.C]]