We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

2m6w

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 3: Line 3:
== Structural highlights ==
== Structural highlights ==
<table><tr><td colspan='2'>[[2m6w]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M6W OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2M6W FirstGlance]. <br>
<table><tr><td colspan='2'>[[2m6w]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M6W OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2M6W FirstGlance]. <br>
-
</td></tr><tr><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2m6w FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m6w OCA], [http://www.rcsb.org/pdb/explore.do?structureId=2m6w RCSB], [http://www.ebi.ac.uk/pdbsum/2m6w PDBsum]</span></td></tr>
+
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2m6w FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m6w OCA], [http://www.rcsb.org/pdb/explore.do?structureId=2m6w RCSB], [http://www.ebi.ac.uk/pdbsum/2m6w PDBsum]</span></td></tr>
-
<table>
+
</table>
__TOC__
__TOC__
</StructureSection>
</StructureSection>
-
[[Category: Karsisiotis, A.]]
+
[[Category: Karsisiotis, A I.]]
[[Category: Silva, M Webba da.]]
[[Category: Silva, M Webba da.]]
[[Category: Dna]]
[[Category: Dna]]
[[Category: Folding topology]]
[[Category: Folding topology]]
[[Category: G-quadruplex]]
[[Category: G-quadruplex]]

Revision as of 08:25, 22 October 2014

Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools