1qwb
From Proteopedia
(Difference between revisions)
Line 3: | Line 3: | ||
== Structural highlights == | == Structural highlights == | ||
<table><tr><td colspan='2'>[[1qwb]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1QWB FirstGlance]. <br> | <table><tr><td colspan='2'>[[1qwb]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1QWB FirstGlance]. <br> | ||
- | </td></tr><tr><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[1ie1|1ie1]], [[1ie2|1ie2]], [[1qwa|1qwa]]</td></tr> | + | </td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[1ie1|1ie1]], [[1ie2|1ie2]], [[1qwa|1qwa]]</td></tr> |
- | <tr><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1qwb FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwb OCA], [http://www.rcsb.org/pdb/explore.do?structureId=1qwb RCSB], [http://www.ebi.ac.uk/pdbsum/1qwb PDBsum]</span></td></tr> | + | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1qwb FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwb OCA], [http://www.rcsb.org/pdb/explore.do?structureId=1qwb RCSB], [http://www.ebi.ac.uk/pdbsum/1qwb PDBsum]</span></td></tr> |
- | <table> | + | </table> |
<div style="background-color:#fffaf0;"> | <div style="background-color:#fffaf0;"> | ||
== Publication Abstract from PubMed == | == Publication Abstract from PubMed == | ||
Line 18: | Line 18: | ||
__TOC__ | __TOC__ | ||
</StructureSection> | </StructureSection> | ||
- | [[Category: Feigon, J | + | [[Category: Feigon, J]] |
- | [[Category: Finger, L D | + | [[Category: Finger, L D]] |
- | [[Category: Johansson, C | + | [[Category: Johansson, C]] |
- | [[Category: Trantirek, L | + | [[Category: Trantirek, L]] |
[[Category: A-form helix]] | [[Category: A-form helix]] | ||
[[Category: Disordered hairpin loop]] | [[Category: Disordered hairpin loop]] |
Revision as of 05:31, 22 December 2014
NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12
|