We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

2mo6

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
-
'''Unreleased structure'''
+
WITHDRAWN: The PDB entry 2MO6 was withdrawn.
-
 
+
-
The entry 2mo6 is ON HOLD until sometime in the future
+
-
 
+
-
Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.
+
-
 
+
-
Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution
+
-
[[Category: Unreleased Structures]]
+
-
[[Category: Karsisiotis, A.I]]
+
-
[[Category: Dvorkin, S.A]]
+
-
[[Category: Webba Da Silva, M]]
+

Revision as of 10:46, 30 April 2015

WITHDRAWN: The PDB entry 2MO6 was withdrawn.

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools