This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


5e3n

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
(New page: '''Unreleased structure''' The entry 5e3n is ON HOLD Authors: Hancock, S.P., Cascio, D., Johnson, R.C. Description: Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTG...)
m (Protected "5e3n" [edit=sysop:move=sysop])

Revision as of 02:56, 16 October 2015

Unreleased structure

The entry 5e3n is ON HOLD

Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools