This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.
Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.
6gh0
From Proteopedia
(Difference between revisions)
(New page: '''Unreleased structure''' The entry 6gh0 is ON HOLD Authors: Description: Category: Unreleased Structures) |
|||
| (2 intermediate revisions not shown.) | |||
| Line 1: | Line 1: | ||
| - | '''Unreleased structure''' | ||
| - | + | ==Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure== | |
| + | <StructureSection load='6gh0' size='340' side='right'caption='[[6gh0]], [[NMR_Ensembles_of_Models | 10 NMR models]]' scene=''> | ||
| + | == Structural highlights == | ||
| + | <table><tr><td colspan='2'>[[6gh0]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=6GH0 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=6GH0 FirstGlance]. <br> | ||
| + | </td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=6gh0 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=6gh0 OCA], [http://pdbe.org/6gh0 PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=6gh0 RCSB], [http://www.ebi.ac.uk/pdbsum/6gh0 PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=6gh0 ProSAT]</span></td></tr> | ||
| + | </table> | ||
| + | <div style="background-color:#fffaf0;"> | ||
| + | == Publication Abstract from PubMed == | ||
| + | In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10*C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression. | ||
| - | + | Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure.,Kotar A, Rigo R, Sissi C, Plavec J Nucleic Acids Res. 2018 Dec 21. pii: 5257350. doi: 10.1093/nar/gky1269. PMID:30590801<ref>PMID:30590801</ref> | |
| - | + | From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br> | |
| - | [[Category: | + | </div> |
| + | <div class="pdbe-citations 6gh0" style="background-color:#fffaf0;"></div> | ||
| + | == References == | ||
| + | <references/> | ||
| + | __TOC__ | ||
| + | </StructureSection> | ||
| + | [[Category: Large Structures]] | ||
| + | [[Category: Kotar, A]] | ||
| + | [[Category: Plavec, J]] | ||
| + | [[Category: Rigo, R]] | ||
| + | [[Category: Sissi, C]] | ||
| + | [[Category: C-kit promoter]] | ||
| + | [[Category: Dna]] | ||
| + | [[Category: G-quadruplex]] | ||
| + | [[Category: Two g-quartet]] | ||
Current revision
Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure
| |||||||||||
Categories: Large Structures | Kotar, A | Plavec, J | Rigo, R | Sissi, C | C-kit promoter | Dna | G-quadruplex | Two g-quartet
