This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.
Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.
5e3l
From Proteopedia
(Difference between revisions)
| Line 1: | Line 1: | ||
==Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)== | ==Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)== | ||
| - | <StructureSection load='5e3l' size='340' side='right' caption='[[5e3l]], [[Resolution|resolution]] 2.66Å' scene=''> | + | <StructureSection load='5e3l' size='340' side='right'caption='[[5e3l]], [[Resolution|resolution]] 2.66Å' scene=''> |
== Structural highlights == | == Structural highlights == | ||
| - | <table><tr><td colspan='2'>[[5e3l]] is a 4 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3L OCA]. For a <b>guided tour on the structure components</b> use [http:// | + | <table><tr><td colspan='2'>[[5e3l]] is a 4 chain structure with sequence from [http://en.wikipedia.org/wiki/Ecoli Ecoli]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3L OCA]. For a <b>guided tour on the structure components</b> use [http://proteopedia.org/fgij/fg.htm?mol=5E3L FirstGlance]. <br> |
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[5e3n|5e3n]], [[5e3o|5e3o]], [[5e3m|5e3m]], [[5ds9|5ds9]], [[5dtd|5dtd]]</td></tr> | </td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[5e3n|5e3n]], [[5e3o|5e3o]], [[5e3m|5e3m]], [[5ds9|5ds9]], [[5dtd|5dtd]]</td></tr> | ||
| - | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http:// | + | <tr id='gene'><td class="sblockLbl"><b>[[Gene|Gene:]]</b></td><td class="sblockDat">fis, b3261, JW3229 ([http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&srchmode=5&id=83333 ECOLI])</td></tr> |
| + | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://proteopedia.org/fgij/fg.htm?mol=5e3l FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5e3l OCA], [http://pdbe.org/5e3l PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5e3l RCSB], [http://www.ebi.ac.uk/pdbsum/5e3l PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=5e3l ProSAT]</span></td></tr> | ||
</table> | </table> | ||
== Function == | == Function == | ||
| Line 18: | Line 19: | ||
</div> | </div> | ||
<div class="pdbe-citations 5e3l" style="background-color:#fffaf0;"></div> | <div class="pdbe-citations 5e3l" style="background-color:#fffaf0;"></div> | ||
| + | |||
| + | ==See Also== | ||
| + | *[[FIS protein|FIS protein]] | ||
== References == | == References == | ||
<references/> | <references/> | ||
__TOC__ | __TOC__ | ||
</StructureSection> | </StructureSection> | ||
| + | [[Category: Ecoli]] | ||
| + | [[Category: Large Structures]] | ||
[[Category: Cascio, D]] | [[Category: Cascio, D]] | ||
[[Category: Hancock, S P]] | [[Category: Hancock, S P]] | ||
Revision as of 06:42, 22 April 2020
Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)
| |||||||||||
