This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


5e3o

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
==Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)==
==Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)==
-
<StructureSection load='5e3o' size='340' side='right' caption='[[5e3o]], [[Resolution|resolution]] 2.78&Aring;' scene=''>
+
<StructureSection load='5e3o' size='340' side='right'caption='[[5e3o]], [[Resolution|resolution]] 2.78&Aring;' scene=''>
== Structural highlights ==
== Structural highlights ==
-
<table><tr><td colspan='2'>[[5e3o]] is a 4 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3O OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5E3O FirstGlance]. <br>
+
<table><tr><td colspan='2'>[[5e3o]] is a 4 chain structure with sequence from [http://en.wikipedia.org/wiki/Ecoli Ecoli]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3O OCA]. For a <b>guided tour on the structure components</b> use [http://proteopedia.org/fgij/fg.htm?mol=5E3O FirstGlance]. <br>
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[5e3l|5e3l]], [[5e3n|5e3n]], [[5e3m|5e3m]], [[5ds9|5ds9]], [[5dtd|5dtd]]</td></tr>
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[5e3l|5e3l]], [[5e3n|5e3n]], [[5e3m|5e3m]], [[5ds9|5ds9]], [[5dtd|5dtd]]</td></tr>
-
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5e3o FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5e3o OCA], [http://pdbe.org/5e3o PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5e3o RCSB], [http://www.ebi.ac.uk/pdbsum/5e3o PDBsum]</span></td></tr>
+
<tr id='gene'><td class="sblockLbl"><b>[[Gene|Gene:]]</b></td><td class="sblockDat">fis, b3261, JW3229 ([http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&srchmode=5&id=83333 ECOLI])</td></tr>
 +
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://proteopedia.org/fgij/fg.htm?mol=5e3o FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5e3o OCA], [http://pdbe.org/5e3o PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5e3o RCSB], [http://www.ebi.ac.uk/pdbsum/5e3o PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=5e3o ProSAT]</span></td></tr>
</table>
</table>
== Function ==
== Function ==
Line 18: Line 19:
</div>
</div>
<div class="pdbe-citations 5e3o" style="background-color:#fffaf0;"></div>
<div class="pdbe-citations 5e3o" style="background-color:#fffaf0;"></div>
 +
 +
==See Also==
 +
*[[FIS protein|FIS protein]]
== References ==
== References ==
<references/>
<references/>
__TOC__
__TOC__
</StructureSection>
</StructureSection>
 +
[[Category: Ecoli]]
 +
[[Category: Large Structures]]
[[Category: Cascio, D]]
[[Category: Cascio, D]]
[[Category: Hancock, S P]]
[[Category: Hancock, S P]]

Revision as of 06:42, 22 April 2020

Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)

PDB ID 5e3o

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools