This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


2m8z

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 3: Line 3:
<StructureSection load='2m8z' size='340' side='right'caption='[[2m8z]]' scene=''>
<StructureSection load='2m8z' size='340' side='right'caption='[[2m8z]]' scene=''>
== Structural highlights ==
== Structural highlights ==
-
<table><tr><td colspan='2'>Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M8Z OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=2M8Z FirstGlance]. <br>
+
<table><tr><td colspan='2'>[[2m8z]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M8Z OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=2M8Z FirstGlance]. <br>
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=2m8z FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m8z OCA], [https://pdbe.org/2m8z PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=2m8z RCSB], [https://www.ebi.ac.uk/pdbsum/2m8z PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=2m8z ProSAT]</span></td></tr>
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=2m8z FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m8z OCA], [https://pdbe.org/2m8z PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=2m8z RCSB], [https://www.ebi.ac.uk/pdbsum/2m8z PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=2m8z ProSAT]</span></td></tr>
</table>
</table>
 +
<div style="background-color:#fffaf0;">
 +
== Publication Abstract from PubMed ==
 +
Coaxial and orthogonal orientations of the helices (left and right illustration, respectively) in a quadruplex-duplex junction were realized by incorporating a duplex hairpin across the diverse geometries of a quadruplex. The modularity of the approach was validated through the simultaneous attachment of multiple duplex stems onto a G-quadruplex scaffold to generate a G-junction.
 +
 +
Structural Basis of DNA Quadruplex-Duplex Junction Formation.,Lim KW, Phan AT Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476<ref>PMID:23794476</ref>
 +
 +
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
 +
</div>
 +
<div class="pdbe-citations 2m8z" style="background-color:#fffaf0;"></div>
 +
== References ==
 +
<references/>
__TOC__
__TOC__
</StructureSection>
</StructureSection>

Revision as of 09:31, 14 June 2023

Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid

PDB ID 2m8z

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools