This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


5j6u

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Current revision (10:11, 14 June 2023) (edit) (undo)
 
(One intermediate revision not shown.)
Line 1: Line 1:
==DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium==
==DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium==
-
<StructureSection load='5j6u' size='340' side='right' caption='[[5j6u]], [[NMR_Ensembles_of_Models | 11 NMR models]]' scene=''>
+
<StructureSection load='5j6u' size='340' side='right'caption='[[5j6u]]' scene=''>
== Structural highlights ==
== Structural highlights ==
-
<table><tr><td colspan='2'>[[5j6u]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5J6U OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5J6U FirstGlance]. <br>
+
<table><tr><td colspan='2'>[[5j6u]] is a 1 chain structure with sequence from [https://en.wikipedia.org/wiki/Synthetic_construct Synthetic construct]. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5J6U OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=5J6U FirstGlance]. <br>
-
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5j6u FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5j6u OCA], [http://pdbe.org/5j6u PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5j6u RCSB], [http://www.ebi.ac.uk/pdbsum/5j6u PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=5j6u ProSAT]</span></td></tr>
+
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=5j6u FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5j6u OCA], [https://pdbe.org/5j6u PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=5j6u RCSB], [https://www.ebi.ac.uk/pdbsum/5j6u PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=5j6u ProSAT]</span></td></tr>
</table>
</table>
<div style="background-color:#fffaf0;">
<div style="background-color:#fffaf0;">
Line 19: Line 19:
__TOC__
__TOC__
</StructureSection>
</StructureSection>
-
[[Category: Dvorkin, S A]]
+
[[Category: Large Structures]]
-
[[Category: Karsisiotis, A I]]
+
[[Category: Synthetic construct]]
-
[[Category: Silva, M Webba da]]
+
[[Category: Dvorkin SA]]
-
[[Category: Dna]]
+
[[Category: Karsisiotis AI]]
-
[[Category: Programmed design of g-quadruplex folding topology]]
+
[[Category: Webba da Silva M]]
-
[[Category: Structure from molmol]]
+

Current revision

DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium

PDB ID 5j6u

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools