This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.
Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.
5j6u
From Proteopedia
(Difference between revisions)
| (One intermediate revision not shown.) | |||
| Line 1: | Line 1: | ||
==DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium== | ==DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium== | ||
| - | <StructureSection load='5j6u' size='340' side='right' caption='[[5j6u | + | <StructureSection load='5j6u' size='340' side='right'caption='[[5j6u]]' scene=''> |
== Structural highlights == | == Structural highlights == | ||
| - | <table><tr><td colspan='2'>[[5j6u]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5J6U OCA]. For a <b>guided tour on the structure components</b> use [ | + | <table><tr><td colspan='2'>[[5j6u]] is a 1 chain structure with sequence from [https://en.wikipedia.org/wiki/Synthetic_construct Synthetic construct]. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5J6U OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=5J6U FirstGlance]. <br> |
| - | </td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[ | + | </td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=5j6u FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5j6u OCA], [https://pdbe.org/5j6u PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=5j6u RCSB], [https://www.ebi.ac.uk/pdbsum/5j6u PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=5j6u ProSAT]</span></td></tr> |
</table> | </table> | ||
<div style="background-color:#fffaf0;"> | <div style="background-color:#fffaf0;"> | ||
| Line 19: | Line 19: | ||
__TOC__ | __TOC__ | ||
</StructureSection> | </StructureSection> | ||
| - | [[Category: | + | [[Category: Large Structures]] |
| - | [[Category: | + | [[Category: Synthetic construct]] |
| - | [[Category: | + | [[Category: Dvorkin SA]] |
| - | [[Category: | + | [[Category: Karsisiotis AI]] |
| - | [[Category: | + | [[Category: Webba da Silva M]] |
| - | + | ||
Current revision
DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium
| |||||||||||
