We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

5e3n

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Current revision (01:22, 28 December 2023) (edit) (undo)
 
(2 intermediate revisions not shown.)

Current revision

Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)

PDB ID 5e3n

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools