This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.
Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.
5e3o
From Proteopedia
(Difference between revisions)
(New page: '''Unreleased structure''' The entry 5e3o is ON HOLD Authors: Hancock, S.P., Cascio, D., Johnson, R.C. Description: Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTC...) |
|||
| (6 intermediate revisions not shown.) | |||
| Line 1: | Line 1: | ||
| - | '''Unreleased structure''' | ||
| - | + | ==Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)== | |
| + | <StructureSection load='5e3o' size='340' side='right'caption='[[5e3o]], [[Resolution|resolution]] 2.78Å' scene=''> | ||
| + | == Structural highlights == | ||
| + | <table><tr><td colspan='2'>[[5e3o]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Escherichia_coli_K-12 Escherichia coli K-12] and [https://en.wikipedia.org/wiki/Synthetic_construct Synthetic construct]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3O OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=5E3O FirstGlance]. <br> | ||
| + | </td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">X-ray diffraction, [[Resolution|Resolution]] 2.78Å</td></tr> | ||
| + | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=5e3o FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5e3o OCA], [https://pdbe.org/5e3o PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=5e3o RCSB], [https://www.ebi.ac.uk/pdbsum/5e3o PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=5e3o ProSAT]</span></td></tr> | ||
| + | </table> | ||
| + | == Function == | ||
| + | [https://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref> | ||
| - | + | ==See Also== | |
| - | + | *[[FIS protein|FIS protein]] | |
| - | + | == References == | |
| - | [[Category: | + | <references/> |
| - | [[Category: | + | __TOC__ |
| - | [[Category: | + | </StructureSection> |
| - | [[Category: Cascio | + | [[Category: Escherichia coli K-12]] |
| + | [[Category: Large Structures]] | ||
| + | [[Category: Synthetic construct]] | ||
| + | [[Category: Cascio D]] | ||
| + | [[Category: Hancock SP]] | ||
| + | [[Category: Johnson RC]] | ||
Current revision
Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)
| |||||||||||
