|
|
| (6 intermediate revisions not shown.) |
| Line 1: |
Line 1: |
| - | ==NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12== | + | |
| - | <StructureSection load='1qwb' size='340' side='right' caption='[[1qwb]], [[NMR_Ensembles_of_Models | 17 NMR models]]' scene=''> | + | ==NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12== |
| | + | <StructureSection load='1qwb' size='340' side='right'caption='[[1qwb]]' scene=''> |
| | == Structural highlights == | | == Structural highlights == |
| - | <table><tr><td colspan='2'>[[1qwb]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1QWB FirstGlance]. <br> | + | <table><tr><td colspan='2'>[[1qwb]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=1QWB FirstGlance]. <br> |
| - | </td></tr><tr><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[1ie1|1ie1]], [[1ie2|1ie2]], [[1qwa|1qwa]]</td></tr> | + | </td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">Solution NMR</td></tr> |
| - | <tr><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1qwb FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwb OCA], [http://www.rcsb.org/pdb/explore.do?structureId=1qwb RCSB], [http://www.ebi.ac.uk/pdbsum/1qwb PDBsum]</span></td></tr> | + | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=1qwb FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwb OCA], [https://pdbe.org/1qwb PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=1qwb RCSB], [https://www.ebi.ac.uk/pdbsum/1qwb PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=1qwb ProSAT]</span></td></tr> |
| - | <table>
| + | </table> |
| - | <div style="background-color:#fffaf0;">
| + | |
| - | == Publication Abstract from PubMed ==
| + | |
| - | Nucleolin, a multi-domain protein involved in ribosome biogenesis, has been shown to bind the consensus sequence (U/G)CCCG(A/G) in the context of a hairpin loop structure (nucleolin recognition element; NRE). Previous studies have shown that the first two RNA-binding domains in nucleolin (RBD12) are responsible for the interaction with the in vitro selected NRE (sNRE). We have previously reported the structures of nucleolin RBD12, sNRE and nucleolin RBD12-sNRE complex. A comparison of free and bound sNRE shows that the NRE loop becomes structured upon binding. From this observation, we hypothesized that the disordered hairpin loop of sNRE facilitates conformational rearrangements when the protein binds. Here, we show that nucleolin RBD12 is also sufficient for sequence- specific binding of two NRE sequences found in pre-rRNA, b1NRE and b2NRE. Structural investigations of the free NREs using NMR spectroscopy show that the b1NRE loop is conformationally heterogeneous, while the b2NRE loop is structured. The b2NRE forms a hairpin capped by a YNMG-like tetraloop. Comparison of the chemical shifts of sNRE and b2NRE in complex with nucleolin RBD12 suggests that the NRE consensus nucleotides adopt a similar conformation. These results show that a disordered NRE consensus sequence is not a prerequisite for nucleolin RBD12 binding.
| + | |
| - | | + | |
| - | Solution structures of stem-loop RNAs that bind to the two N-terminal RNA-binding domains of nucleolin.,Finger LD, Trantirek L, Johansson C, Feigon J Nucleic Acids Res. 2003 Nov 15;31(22):6461-72. PMID:14602904<ref>PMID:14602904</ref>
| + | |
| - | | + | |
| - | From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br>
| + | |
| - | </div> | + | |
| - | == References ==
| + | |
| - | <references/> | + | |
| | __TOC__ | | __TOC__ |
| | </StructureSection> | | </StructureSection> |
| - | [[Category: Feigon, J.]] | + | [[Category: Large Structures]] |
| - | [[Category: Finger, L D.]] | + | [[Category: Feigon J]] |
| - | [[Category: Johansson, C.]] | + | [[Category: Finger LD]] |
| - | [[Category: Trantirek, L.]] | + | [[Category: Johansson C]] |
| - | [[Category: A-form helix]]
| + | [[Category: Trantirek L]] |
| - | [[Category: Disordered hairpin loop]]
| + | |
| - | [[Category: Loop e motif]]
| + | |
| - | [[Category: Rna]]
| + | |
| - | [[Category: S-turn]]
| + | |
