1qwb

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Current revision (06:07, 17 April 2024) (edit) (undo)
 
(9 intermediate revisions not shown.)
Line 1: Line 1:
-
{{Seed}}
 
-
[[Image:1qwb.png|left|200px]]
 
-
<!--
+
==NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12==
-
The line below this paragraph, containing "STRUCTURE_1qwb", creates the "Structure Box" on the page.
+
<StructureSection load='1qwb' size='340' side='right'caption='[[1qwb]]' scene=''>
-
You may change the PDB parameter (which sets the PDB file loaded into the applet)
+
== Structural highlights ==
-
or the SCENE parameter (which sets the initial scene displayed when the page is loaded),
+
<table><tr><td colspan='2'>[[1qwb]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=1QWB FirstGlance]. <br>
-
or leave the SCENE parameter empty for the default display.
+
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">Solution NMR</td></tr>
-
-->
+
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=1qwb FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwb OCA], [https://pdbe.org/1qwb PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=1qwb RCSB], [https://www.ebi.ac.uk/pdbsum/1qwb PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=1qwb ProSAT]</span></td></tr>
-
{{STRUCTURE_1qwb| PDB=1qwb | SCENE= }}
+
</table>
-
 
+
__TOC__
-
===NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12===
+
</StructureSection>
-
 
+
[[Category: Large Structures]]
-
 
+
[[Category: Feigon J]]
-
<!--
+
[[Category: Finger LD]]
-
The line below this paragraph, {{ABSTRACT_PUBMED_14602904}}, adds the Publication Abstract to the page
+
[[Category: Johansson C]]
-
(as it appears on PubMed at http://www.pubmed.gov), where 14602904 is the PubMed ID number.
+
[[Category: Trantirek L]]
-
-->
+
-
{{ABSTRACT_PUBMED_14602904}}
+
-
 
+
-
==About this Structure==
+
-
Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA].
+
-
 
+
-
==Reference==
+
-
Solution structures of stem-loop RNAs that bind to the two N-terminal RNA-binding domains of nucleolin., Finger LD, Trantirek L, Johansson C, Feigon J, Nucleic Acids Res. 2003 Nov 15;31(22):6461-72. PMID:[http://www.ncbi.nlm.nih.gov/pubmed/14602904 14602904]
+
-
[[Category: Feigon, J.]]
+
-
[[Category: Finger, L D.]]
+
-
[[Category: Johansson, C.]]
+
-
[[Category: Trantirek, L.]]
+
-
[[Category: A-form helix]]
+
-
[[Category: Disordered hairpin loop]]
+
-
[[Category: Loop e motif]]
+
-
[[Category: S-turn]]
+
-
 
+
-
''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Mon Jul 28 10:48:43 2008''
+

Current revision

NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12

PDB ID 1qwb

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Retrieved from "http://52.214.119.220/wiki/index.php/1qwb"
Personal tools