This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.
Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.
2m93
From Proteopedia
(Difference between revisions)
| (7 intermediate revisions not shown.) | |||
| Line 1: | Line 1: | ||
| - | {{STRUCTURE_2m93| PDB=2m93 | SCENE= }} | ||
| - | ===Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex hybrid=== | ||
| - | {{ABSTRACT_PUBMED_23794476}} | ||
| - | == | + | ==Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex hybrid== |
| - | [[2m93]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M93 OCA]. | + | <StructureSection load='2m93' size='340' side='right'caption='[[2m93]]' scene=''> |
| + | == Structural highlights == | ||
| + | <table><tr><td colspan='2'>[[2m93]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M93 OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=2M93 FirstGlance]. <br> | ||
| + | </td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">Solution NMR</td></tr> | ||
| + | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=2m93 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m93 OCA], [https://pdbe.org/2m93 PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=2m93 RCSB], [https://www.ebi.ac.uk/pdbsum/2m93 PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=2m93 ProSAT]</span></td></tr> | ||
| + | </table> | ||
| + | <div style="background-color:#fffaf0;"> | ||
| + | == Publication Abstract from PubMed == | ||
| + | Coaxial and orthogonal orientations of the helices (left and right illustration, respectively) in a quadruplex-duplex junction were realized by incorporating a duplex hairpin across the diverse geometries of a quadruplex. The modularity of the approach was validated through the simultaneous attachment of multiple duplex stems onto a G-quadruplex scaffold to generate a G-junction. | ||
| - | + | Structural Basis of DNA Quadruplex-Duplex Junction Formation.,Lim KW, Phan AT Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476<ref>PMID:23794476</ref> | |
| - | <ref | + | |
| - | + | From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br> | |
| - | + | </div> | |
| - | [[Category: | + | <div class="pdbe-citations 2m93" style="background-color:#fffaf0;"></div> |
| - | [[Category: | + | == References == |
| - | [[Category: | + | <references/> |
| - | + | __TOC__ | |
| + | </StructureSection> | ||
| + | [[Category: Large Structures]] | ||
| + | [[Category: Lim KW]] | ||
| + | [[Category: Phan AT]] | ||
Current revision
Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex hybrid
| |||||||||||
