5j6u
From Proteopedia
(Difference between revisions)
| (4 intermediate revisions not shown.) | |||
| Line 1: | Line 1: | ||
| - | '''Unreleased structure''' | ||
| - | + | ==DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium== | |
| + | <StructureSection load='5j6u' size='340' side='right'caption='[[5j6u]]' scene=''> | ||
| + | == Structural highlights == | ||
| + | <table><tr><td colspan='2'>[[5j6u]] is a 1 chain structure with sequence from [https://en.wikipedia.org/wiki/Synthetic_construct Synthetic construct]. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5J6U OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=5J6U FirstGlance]. <br> | ||
| + | </td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">Solution NMR</td></tr> | ||
| + | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=5j6u FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5j6u OCA], [https://pdbe.org/5j6u PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=5j6u RCSB], [https://www.ebi.ac.uk/pdbsum/5j6u PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=5j6u ProSAT]</span></td></tr> | ||
| + | </table> | ||
| + | <div style="background-color:#fffaf0;"> | ||
| + | == Publication Abstract from PubMed == | ||
| + | The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications. | ||
| - | + | Encoding canonical DNA quadruplex structure.,Dvorkin SA, Karsisiotis AI, Webba da Silva M Sci Adv. 2018 Aug 31;4(8):eaat3007. doi: 10.1126/sciadv.aat3007. eCollection 2018, Aug. PMID:30182059<ref>PMID:30182059</ref> | |
| - | + | From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br> | |
| - | [[Category: | + | </div> |
| - | [[Category: | + | <div class="pdbe-citations 5j6u" style="background-color:#fffaf0;"></div> |
| - | [[Category: Dvorkin | + | == References == |
| - | [[Category: Webba | + | <references/> |
| + | __TOC__ | ||
| + | </StructureSection> | ||
| + | [[Category: Large Structures]] | ||
| + | [[Category: Synthetic construct]] | ||
| + | [[Category: Dvorkin SA]] | ||
| + | [[Category: Karsisiotis AI]] | ||
| + | [[Category: Webba da Silva M]] | ||
Current revision
DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium
| |||||||||||
