5j6u
From Proteopedia
(Difference between revisions)
| (2 intermediate revisions not shown.) | |||
| Line 1: | Line 1: | ||
==DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium== | ==DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium== | ||
| - | <StructureSection load='5j6u' size='340' side='right' caption='[[5j6u | + | <StructureSection load='5j6u' size='340' side='right'caption='[[5j6u]]' scene=''> |
== Structural highlights == | == Structural highlights == | ||
| - | <table><tr><td colspan='2'>[[5j6u]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5J6U OCA]. For a <b>guided tour on the structure components</b> use [ | + | <table><tr><td colspan='2'>[[5j6u]] is a 1 chain structure with sequence from [https://en.wikipedia.org/wiki/Synthetic_construct Synthetic construct]. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5J6U OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=5J6U FirstGlance]. <br> |
| - | </td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[ | + | </td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">Solution NMR</td></tr> |
| + | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=5j6u FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5j6u OCA], [https://pdbe.org/5j6u PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=5j6u RCSB], [https://www.ebi.ac.uk/pdbsum/5j6u PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=5j6u ProSAT]</span></td></tr> | ||
</table> | </table> | ||
<div style="background-color:#fffaf0;"> | <div style="background-color:#fffaf0;"> | ||
| Line 19: | Line 20: | ||
__TOC__ | __TOC__ | ||
</StructureSection> | </StructureSection> | ||
| - | [[Category: | + | [[Category: Large Structures]] |
| - | [[Category: | + | [[Category: Synthetic construct]] |
| - | [[Category: | + | [[Category: Dvorkin SA]] |
| - | [[Category: | + | [[Category: Karsisiotis AI]] |
| - | [[Category: | + | [[Category: Webba da Silva M]] |
| - | + | ||
Current revision
DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium
| |||||||||||
