We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

9pz7

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
(New page: '''Unreleased structure''' The entry 9pz7 is ON HOLD Authors: Werther, R., Stoddard, B.L. Description: Engineered variant of I-OnuI meganuclease to target DNA sequence TTTCCACTTATTCACT...)
m (Protected "9pz7" [edit=sysop:move=sysop])

Revision as of 04:54, 20 August 2025

Unreleased structure

The entry 9pz7 is ON HOLD

Authors: Werther, R., Stoddard, B.L.

Description: Engineered variant of I-OnuI meganuclease to target DNA sequence TTTCCACTTATTCACTATTTTA

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools