1qwb

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
-
[[Image:1qwb.gif|left|200px]]
+
{{Seed}}
 +
[[Image:1qwb.png|left|200px]]
<!--
<!--
Line 9: Line 10:
{{STRUCTURE_1qwb| PDB=1qwb | SCENE= }}
{{STRUCTURE_1qwb| PDB=1qwb | SCENE= }}
-
'''NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12'''
+
===NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12===
-
==Overview==
+
<!--
-
Nucleolin, a multi-domain protein involved in ribosome biogenesis, has been shown to bind the consensus sequence (U/G)CCCG(A/G) in the context of a hairpin loop structure (nucleolin recognition element; NRE). Previous studies have shown that the first two RNA-binding domains in nucleolin (RBD12) are responsible for the interaction with the in vitro selected NRE (sNRE). We have previously reported the structures of nucleolin RBD12, sNRE and nucleolin RBD12-sNRE complex. A comparison of free and bound sNRE shows that the NRE loop becomes structured upon binding. From this observation, we hypothesized that the disordered hairpin loop of sNRE facilitates conformational rearrangements when the protein binds. Here, we show that nucleolin RBD12 is also sufficient for sequence- specific binding of two NRE sequences found in pre-rRNA, b1NRE and b2NRE. Structural investigations of the free NREs using NMR spectroscopy show that the b1NRE loop is conformationally heterogeneous, while the b2NRE loop is structured. The b2NRE forms a hairpin capped by a YNMG-like tetraloop. Comparison of the chemical shifts of sNRE and b2NRE in complex with nucleolin RBD12 suggests that the NRE consensus nucleotides adopt a similar conformation. These results show that a disordered NRE consensus sequence is not a prerequisite for nucleolin RBD12 binding.
+
The line below this paragraph, {{ABSTRACT_PUBMED_14602904}}, adds the Publication Abstract to the page
 +
(as it appears on PubMed at http://www.pubmed.gov), where 14602904 is the PubMed ID number.
 +
-->
 +
{{ABSTRACT_PUBMED_14602904}}
==About this Structure==
==About this Structure==
-
Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA].
+
Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA].
==Reference==
==Reference==
Line 28: Line 32:
[[Category: Loop e motif]]
[[Category: Loop e motif]]
[[Category: S-turn]]
[[Category: S-turn]]
-
''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Sat May 3 06:46:24 2008''
+
 
 +
''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Mon Jul 28 10:48:43 2008''

Revision as of 07:48, 28 July 2008

Image:1qwb.png

Template:STRUCTURE 1qwb

NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12

Template:ABSTRACT PUBMED 14602904

About this Structure

Full experimental information is available from OCA.

Reference

Solution structures of stem-loop RNAs that bind to the two N-terminal RNA-binding domains of nucleolin., Finger LD, Trantirek L, Johansson C, Feigon J, Nucleic Acids Res. 2003 Nov 15;31(22):6461-72. PMID:14602904

Page seeded by OCA on Mon Jul 28 10:48:43 2008

Proteopedia Page Contributors and Editors (what is this?)

OCA

Retrieved from "http://52.214.119.220/wiki/index.php/1qwb"
Personal tools