4ihv
From Proteopedia
(Difference between revisions)
m (Protected "4ihv" [edit=sysop:move=sysop]) |
|||
| (7 intermediate revisions not shown.) | |||
| Line 1: | Line 1: | ||
| - | '''Unreleased structure''' | ||
| - | + | ==Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)== | |
| + | <StructureSection load='4ihv' size='340' side='right'caption='[[4ihv]], [[Resolution|resolution]] 2.72Å' scene=''> | ||
| + | == Structural highlights == | ||
| + | <table><tr><td colspan='2'>[[4ihv]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Escherichia_coli_K-12 Escherichia coli K-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=4IHV FirstGlance]. <br> | ||
| + | </td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">X-ray diffraction, [[Resolution|Resolution]] 2.716Å</td></tr> | ||
| + | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=4ihv FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4ihv OCA], [https://pdbe.org/4ihv PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=4ihv RCSB], [https://www.ebi.ac.uk/pdbsum/4ihv PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=4ihv ProSAT]</span></td></tr> | ||
| + | </table> | ||
| + | <div style="background-color:#fffaf0;"> | ||
| + | == Publication Abstract from PubMed == | ||
| + | The width of the DNA minor groove varies with sequence and can be a major determinant of DNA shape recognition by proteins. For example, the minor groove within the center of the Fis-DNA complex narrows to about half the mean minor groove width of canonical B-form DNA to fit onto the protein surface. G/C base pairs within this segment, which is not contacted by the Fis protein, reduce binding affinities up to 2000-fold over A/T-rich sequences. We show here through multiple X-ray structures and binding properties of Fis-DNA complexes containing base analogs that the 2-amino group on guanine is the primary molecular determinant controlling minor groove widths. Molecular dynamics simulations of free-DNA targets with canonical and modified bases further demonstrate that sequence-dependent narrowing of minor groove widths is modulated almost entirely by the presence of purine 2-amino groups. We also provide evidence that protein-mediated phosphate neutralization facilitates minor groove compression and is particularly important for binding to non-optimally shaped DNA duplexes. | ||
| - | + | Control of DNA minor groove width and Fis protein binding by the purine 2-amino group.,Hancock SP, Ghane T, Cascio D, Rohs R, Di Felice R, Johnson RC Nucleic Acids Res. 2013 May 9. PMID:23661683<ref>PMID:23661683</ref> | |
| - | + | From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br> | |
| + | </div> | ||
| + | <div class="pdbe-citations 4ihv" style="background-color:#fffaf0;"></div> | ||
| + | |||
| + | ==See Also== | ||
| + | *[[FIS protein|FIS protein]] | ||
| + | == References == | ||
| + | <references/> | ||
| + | __TOC__ | ||
| + | </StructureSection> | ||
| + | [[Category: Escherichia coli K-12]] | ||
| + | [[Category: Large Structures]] | ||
| + | [[Category: Cascio D]] | ||
| + | [[Category: Hancock SP]] | ||
| + | [[Category: Johnson RC]] | ||
Current revision
Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
| |||||||||||
