2m6w

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
(New page: '''Unreleased structure''' The entry 2m6w is ON HOLD Authors: Karsisiotis, A., Webba da Silva, M. Description: Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in s...)
Current revision (06:01, 15 May 2024) (edit) (undo)
 
(12 intermediate revisions not shown.)
Line 1: Line 1:
-
'''Unreleased structure'''
 
-
The entry 2m6w is ON HOLD
+
==Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions==
 +
<StructureSection load='2m6w' size='340' side='right'caption='[[2m6w]]' scene=''>
 +
== Structural highlights ==
 +
<table><tr><td colspan='2'>[[2m6w]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M6W OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=2M6W FirstGlance]. <br>
 +
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">Solution NMR</td></tr>
 +
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=2m6w FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m6w OCA], [https://pdbe.org/2m6w PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=2m6w RCSB], [https://www.ebi.ac.uk/pdbsum/2m6w PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=2m6w ProSAT]</span></td></tr>
 +
</table>
 +
<div style="background-color:#fffaf0;">
 +
== Publication Abstract from PubMed ==
 +
The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications.
-
Authors: Karsisiotis, A., Webba da Silva, M.
+
Encoding canonical DNA quadruplex structure.,Dvorkin SA, Karsisiotis AI, Webba da Silva M Sci Adv. 2018 Aug 31;4(8):eaat3007. doi: 10.1126/sciadv.aat3007. eCollection 2018, Aug. PMID:30182059<ref>PMID:30182059</ref>
-
Description: Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions
+
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
 +
</div>
 +
<div class="pdbe-citations 2m6w" style="background-color:#fffaf0;"></div>
 +
== References ==
 +
<references/>
 +
__TOC__
 +
</StructureSection>
 +
[[Category: Large Structures]]
 +
[[Category: Karsisiotis AI]]
 +
[[Category: Webba da Silva M]]

Current revision

Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions

PDB ID 2m6w

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools