4ihv

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Current revision (15:23, 20 September 2023) (edit) (undo)
 
(5 intermediate revisions not shown.)
Line 1: Line 1:
-
{{STRUCTURE_4ihv| PDB=4ihv | SCENE= }}
 
-
===Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)===
 
-
==Function==
+
==Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)==
-
[[http://www.uniprot.org/uniprot/C9QXL3_ECOD1 C9QXL3_ECOD1]] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166]
+
<StructureSection load='4ihv' size='340' side='right'caption='[[4ihv]], [[Resolution|resolution]] 2.72&Aring;' scene=''>
 +
== Structural highlights ==
 +
<table><tr><td colspan='2'>[[4ihv]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Escherichia_coli_K-12 Escherichia coli K-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=4IHV FirstGlance]. <br>
 +
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">X-ray diffraction, [[Resolution|Resolution]] 2.716&#8491;</td></tr>
 +
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=4ihv FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4ihv OCA], [https://pdbe.org/4ihv PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=4ihv RCSB], [https://www.ebi.ac.uk/pdbsum/4ihv PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=4ihv ProSAT]</span></td></tr>
 +
</table>
 +
<div style="background-color:#fffaf0;">
 +
== Publication Abstract from PubMed ==
 +
The width of the DNA minor groove varies with sequence and can be a major determinant of DNA shape recognition by proteins. For example, the minor groove within the center of the Fis-DNA complex narrows to about half the mean minor groove width of canonical B-form DNA to fit onto the protein surface. G/C base pairs within this segment, which is not contacted by the Fis protein, reduce binding affinities up to 2000-fold over A/T-rich sequences. We show here through multiple X-ray structures and binding properties of Fis-DNA complexes containing base analogs that the 2-amino group on guanine is the primary molecular determinant controlling minor groove widths. Molecular dynamics simulations of free-DNA targets with canonical and modified bases further demonstrate that sequence-dependent narrowing of minor groove widths is modulated almost entirely by the presence of purine 2-amino groups. We also provide evidence that protein-mediated phosphate neutralization facilitates minor groove compression and is particularly important for binding to non-optimally shaped DNA duplexes.
-
==About this Structure==
+
Control of DNA minor groove width and Fis protein binding by the purine 2-amino group.,Hancock SP, Ghane T, Cascio D, Rohs R, Di Felice R, Johnson RC Nucleic Acids Res. 2013 May 9. PMID:23661683<ref>PMID:23661683</ref>
-
[[4ihv]] is a 4 chain structure with sequence from [http://en.wikipedia.org/wiki/Escherichia_coli_k-12 Escherichia coli k-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA].
+
 
-
[[Category: Escherichia coli k-12]]
+
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
-
[[Category: Cascio, D.]]
+
</div>
-
[[Category: Hancock, S P.]]
+
<div class="pdbe-citations 4ihv" style="background-color:#fffaf0;"></div>
-
[[Category: Johnson, R C.]]
+
 
-
[[Category: Dna bending]]
+
==See Also==
-
[[Category: Hth domain]]
+
*[[FIS protein|FIS protein]]
-
[[Category: Indirect recognition]]
+
== References ==
-
[[Category: Minor groove compression]]
+
<references/>
-
[[Category: Protein-dna complex]]
+
__TOC__
-
[[Category: Transcription-dna complex]]
+
</StructureSection>
 +
[[Category: Escherichia coli K-12]]
 +
[[Category: Large Structures]]
 +
[[Category: Cascio D]]
 +
[[Category: Hancock SP]]
 +
[[Category: Johnson RC]]

Current revision

Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)

PDB ID 4ihv

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools