2m8z

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Current revision (06:02, 15 May 2024) (edit) (undo)
 
(7 intermediate revisions not shown.)
Line 1: Line 1:
-
{{STRUCTURE_2m8z| PDB=2m8z | SCENE= }}
 
-
===Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid===
 
-
{{ABSTRACT_PUBMED_23794476}}
 
-
==About this Structure==
+
==Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid==
-
[[2m8z]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M8Z OCA].
+
<StructureSection load='2m8z' size='340' side='right'caption='[[2m8z]]' scene=''>
 +
== Structural highlights ==
 +
<table><tr><td colspan='2'>[[2m8z]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M8Z OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=2M8Z FirstGlance]. <br>
 +
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">Solution NMR</td></tr>
 +
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=2m8z FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m8z OCA], [https://pdbe.org/2m8z PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=2m8z RCSB], [https://www.ebi.ac.uk/pdbsum/2m8z PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=2m8z ProSAT]</span></td></tr>
 +
</table>
 +
<div style="background-color:#fffaf0;">
 +
== Publication Abstract from PubMed ==
 +
Coaxial and orthogonal orientations of the helices (left and right illustration, respectively) in a quadruplex-duplex junction were realized by incorporating a duplex hairpin across the diverse geometries of a quadruplex. The modularity of the approach was validated through the simultaneous attachment of multiple duplex stems onto a G-quadruplex scaffold to generate a G-junction.
-
==Reference==
+
Structural Basis of DNA Quadruplex-Duplex Junction Formation.,Lim KW, Phan AT Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476<ref>PMID:23794476</ref>
-
<ref group="xtra">PMID:023794476</ref><references group="xtra"/><references/>
+
 
-
[[Category: Lim, K W.]]
+
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
-
[[Category: Phan, A T.]]
+
</div>
-
[[Category: Dna]]
+
<div class="pdbe-citations 2m8z" style="background-color:#fffaf0;"></div>
-
[[Category: Duplex]]
+
== References ==
-
[[Category: Quadruplex]]
+
<references/>
-
[[Category: Quadruplex-duplex hybrid]]
+
__TOC__
 +
</StructureSection>
 +
[[Category: Large Structures]]
 +
[[Category: Lim KW]]
 +
[[Category: Phan AT]]

Current revision

Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid

PDB ID 2m8z

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools