We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

2mo6

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
m (Protected "2mo6" [edit=sysop:move=sysop])
Current revision (19:47, 24 June 2020) (edit) (undo)
 
(3 intermediate revisions not shown.)
Line 1: Line 1:
-
'''Unreleased structure'''
+
WITHDRAWN: The PDB entry 2MO6 was withdrawn.
-
 
+
-
The entry 2mo6 is ON HOLD until sometime in the future
+
-
 
+
-
Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.
+
-
 
+
-
Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution
+

Current revision

WITHDRAWN: The PDB entry 2MO6 was withdrawn.

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools