This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


2m92

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Current revision (06:02, 15 May 2024) (edit) (undo)
 
(6 intermediate revisions not shown.)
Line 1: Line 1:
 +
==Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex hybrid==
==Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex hybrid==
-
<StructureSection load='2m92' size='340' side='right' caption='[[2m92]], [[NMR_Ensembles_of_Models | 10 NMR models]]' scene=''>
+
<StructureSection load='2m92' size='340' side='right'caption='[[2m92]]' scene=''>
== Structural highlights ==
== Structural highlights ==
-
<table><tr><td colspan='2'>[[2m92]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M92 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2M92 FirstGlance]. <br>
+
<table><tr><td colspan='2'>[[2m92]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M92 OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=2M92 FirstGlance]. <br>
-
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[2m8y|2m8y]], [[2m8z|2m8z]], [[2m90|2m90]], [[2m91|2m91]], [[2m93|2m93]]</td></tr>
+
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">Solution NMR</td></tr>
-
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2m92 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m92 OCA], [http://www.rcsb.org/pdb/explore.do?structureId=2m92 RCSB], [http://www.ebi.ac.uk/pdbsum/2m92 PDBsum]</span></td></tr>
+
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=2m92 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m92 OCA], [https://pdbe.org/2m92 PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=2m92 RCSB], [https://www.ebi.ac.uk/pdbsum/2m92 PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=2m92 ProSAT]</span></td></tr>
</table>
</table>
<div style="background-color:#fffaf0;">
<div style="background-color:#fffaf0;">
Line 14: Line 15:
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
</div>
</div>
 +
<div class="pdbe-citations 2m92" style="background-color:#fffaf0;"></div>
== References ==
== References ==
<references/>
<references/>
__TOC__
__TOC__
</StructureSection>
</StructureSection>
-
[[Category: Lim, K W]]
+
[[Category: Large Structures]]
-
[[Category: Phan, A T]]
+
[[Category: Lim KW]]
-
[[Category: Dna]]
+
[[Category: Phan AT]]
-
[[Category: Duplex]]
+
-
[[Category: Quadruplex]]
+
-
[[Category: Quadruplex-duplex hybrid]]
+

Current revision

Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex hybrid

PDB ID 2m92

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools