We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.
4ihv
From Proteopedia
(Difference between revisions)
| (3 intermediate revisions not shown.) | |||
| Line 1: | Line 1: | ||
| + | |||
==Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)== | ==Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)== | ||
| - | <StructureSection load='4ihv' size='340' side='right' caption='[[4ihv]], [[Resolution|resolution]] 2.72Å' scene=''> | + | <StructureSection load='4ihv' size='340' side='right'caption='[[4ihv]], [[Resolution|resolution]] 2.72Å' scene=''> |
== Structural highlights == | == Structural highlights == | ||
| - | <table><tr><td colspan='2'>[[4ihv]] is a 4 chain structure with sequence from [ | + | <table><tr><td colspan='2'>[[4ihv]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Escherichia_coli_K-12 Escherichia coli K-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=4IHV FirstGlance]. <br> |
| - | </td></tr><tr id=' | + | </td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">X-ray diffraction, [[Resolution|Resolution]] 2.716Å</td></tr> |
| - | + | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=4ihv FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4ihv OCA], [https://pdbe.org/4ihv PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=4ihv RCSB], [https://www.ebi.ac.uk/pdbsum/4ihv PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=4ihv ProSAT]</span></td></tr> | |
| - | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[ | + | |
</table> | </table> | ||
<div style="background-color:#fffaf0;"> | <div style="background-color:#fffaf0;"> | ||
| Line 15: | Line 15: | ||
From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br> | From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br> | ||
</div> | </div> | ||
| + | <div class="pdbe-citations 4ihv" style="background-color:#fffaf0;"></div> | ||
==See Also== | ==See Also== | ||
| Line 22: | Line 23: | ||
__TOC__ | __TOC__ | ||
</StructureSection> | </StructureSection> | ||
| - | [[Category: Escherichia coli | + | [[Category: Escherichia coli K-12]] |
| - | [[Category: | + | [[Category: Large Structures]] |
| - | [[Category: | + | [[Category: Cascio D]] |
| - | [[Category: | + | [[Category: Hancock SP]] |
| - | [[Category: | + | [[Category: Johnson RC]] |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
Current revision
Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
| |||||||||||
