This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


2mo6

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Current revision (19:47, 24 June 2020) (edit) (undo)
 
(2 intermediate revisions not shown.)
Line 1: Line 1:
-
'''Unreleased structure'''
+
WITHDRAWN: The PDB entry 2MO6 was withdrawn.
-
 
+
-
The entry 2mo6 is ON HOLD until sometime in the future
+
-
 
+
-
Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.
+
-
 
+
-
Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution
+
-
[[Category: Unreleased Structures]]
+
-
[[Category: Karsisiotis, A.I]]
+
-
[[Category: Dvorkin, S.A]]
+
-
[[Category: Webba Da Silva, M]]
+

Current revision

WITHDRAWN: The PDB entry 2MO6 was withdrawn.

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools