5e3l

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
(New page: '''Unreleased structure''' The entry 5e3l is ON HOLD Authors: Hancock, S.P., Cascio, D., Johnson, R.C. Description: Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTG...)
Current revision (12:27, 6 March 2024) (edit) (undo)
 
(5 intermediate revisions not shown.)
Line 1: Line 1:
-
'''Unreleased structure'''
 
-
The entry 5e3l is ON HOLD
+
==Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)==
 +
<StructureSection load='5e3l' size='340' side='right'caption='[[5e3l]], [[Resolution|resolution]] 2.66&Aring;' scene=''>
 +
== Structural highlights ==
 +
<table><tr><td colspan='2'>[[5e3l]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Escherichia_coli_K-12 Escherichia coli K-12] and [https://en.wikipedia.org/wiki/Synthetic_construct Synthetic construct]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3L OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=5E3L FirstGlance]. <br>
 +
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">X-ray diffraction, [[Resolution|Resolution]] 2.66&#8491;</td></tr>
 +
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=5e3l FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5e3l OCA], [https://pdbe.org/5e3l PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=5e3l RCSB], [https://www.ebi.ac.uk/pdbsum/5e3l PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=5e3l ProSAT]</span></td></tr>
 +
</table>
 +
== Function ==
 +
[https://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref>
-
Authors: Hancock, S.P., Cascio, D., Johnson, R.C.
+
==See Also==
-
 
+
*[[FIS protein|FIS protein]]
-
Description: Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)
+
== References ==
-
[[Category: Unreleased Structures]]
+
<references/>
-
[[Category: Hancock, S.P]]
+
__TOC__
-
[[Category: Johnson, R.C]]
+
</StructureSection>
-
[[Category: Cascio, D]]
+
[[Category: Escherichia coli K-12]]
 +
[[Category: Large Structures]]
 +
[[Category: Synthetic construct]]
 +
[[Category: Cascio D]]
 +
[[Category: Hancock SP]]
 +
[[Category: Johnson RC]]

Current revision

Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)

PDB ID 5e3l

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools