5e3l
From Proteopedia
(Difference between revisions)
| (3 intermediate revisions not shown.) | |||
| Line 1: | Line 1: | ||
| - | '''Unreleased structure''' | ||
| - | + | ==Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)== | |
| + | <StructureSection load='5e3l' size='340' side='right'caption='[[5e3l]], [[Resolution|resolution]] 2.66Å' scene=''> | ||
| + | == Structural highlights == | ||
| + | <table><tr><td colspan='2'>[[5e3l]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Escherichia_coli_K-12 Escherichia coli K-12] and [https://en.wikipedia.org/wiki/Synthetic_construct Synthetic construct]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3L OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=5E3L FirstGlance]. <br> | ||
| + | </td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">X-ray diffraction, [[Resolution|Resolution]] 2.66Å</td></tr> | ||
| + | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=5e3l FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5e3l OCA], [https://pdbe.org/5e3l PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=5e3l RCSB], [https://www.ebi.ac.uk/pdbsum/5e3l PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=5e3l ProSAT]</span></td></tr> | ||
| + | </table> | ||
| + | == Function == | ||
| + | [https://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref> | ||
| - | + | ==See Also== | |
| - | + | *[[FIS protein|FIS protein]] | |
| - | + | == References == | |
| - | [[Category: | + | <references/> |
| - | [[Category: | + | __TOC__ |
| - | [[Category: | + | </StructureSection> |
| - | [[Category: | + | [[Category: Escherichia coli K-12]] |
| + | [[Category: Large Structures]] | ||
| + | [[Category: Synthetic construct]] | ||
| + | [[Category: Cascio D]] | ||
| + | [[Category: Hancock SP]] | ||
| + | [[Category: Johnson RC]] | ||
Current revision
Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)
| |||||||||||
