We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

5e3n

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Current revision (01:22, 28 December 2023) (edit) (undo)
 
(2 intermediate revisions not shown.)
Line 1: Line 1:
==Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)==
==Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)==
-
<StructureSection load='5e3n' size='340' side='right' caption='[[5e3n]], [[Resolution|resolution]] 2.66&Aring;' scene=''>
+
<StructureSection load='5e3n' size='340' side='right'caption='[[5e3n]], [[Resolution|resolution]] 2.66&Aring;' scene=''>
== Structural highlights ==
== Structural highlights ==
-
<table><tr><td colspan='2'>[[5e3n]] is a 4 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3N OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5E3N FirstGlance]. <br>
+
<table><tr><td colspan='2'>[[5e3n]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Escherichia_coli_K-12 Escherichia coli K-12] and [https://en.wikipedia.org/wiki/Synthetic_construct Synthetic construct]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3N OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=5E3N FirstGlance]. <br>
-
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[5e3l|5e3l]], [[5e3o|5e3o]], [[5e3m|5e3m]], [[5ds9|5ds9]], [[5dtd|5dtd]]</td></tr>
+
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">X-ray diffraction, [[Resolution|Resolution]] 2.66&#8491;</td></tr>
-
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5e3n FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5e3n OCA], [http://pdbe.org/5e3n PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5e3n RCSB], [http://www.ebi.ac.uk/pdbsum/5e3n PDBsum]</span></td></tr>
+
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=5e3n FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5e3n OCA], [https://pdbe.org/5e3n PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=5e3n RCSB], [https://www.ebi.ac.uk/pdbsum/5e3n PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=5e3n ProSAT]</span></td></tr>
</table>
</table>
== Function ==
== Function ==
-
[[http://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI]] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref>
+
[https://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref>
<div style="background-color:#fffaf0;">
<div style="background-color:#fffaf0;">
== Publication Abstract from PubMed ==
== Publication Abstract from PubMed ==
Line 18: Line 18:
</div>
</div>
<div class="pdbe-citations 5e3n" style="background-color:#fffaf0;"></div>
<div class="pdbe-citations 5e3n" style="background-color:#fffaf0;"></div>
 +
 +
==See Also==
 +
*[[FIS protein|FIS protein]]
== References ==
== References ==
<references/>
<references/>
__TOC__
__TOC__
</StructureSection>
</StructureSection>
-
[[Category: Cascio, D]]
+
[[Category: Escherichia coli K-12]]
-
[[Category: Hancock, S P]]
+
[[Category: Large Structures]]
-
[[Category: Johnson, R C]]
+
[[Category: Synthetic construct]]
-
[[Category: Dna bending]]
+
[[Category: Cascio D]]
-
[[Category: Dna binding protein-dna complex]]
+
[[Category: Hancock SP]]
-
[[Category: Hth domain]]
+
[[Category: Johnson RC]]
-
[[Category: Indirect recognition]]
+
-
[[Category: Protein-dna complex]]
+

Current revision

Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)

PDB ID 5e3n

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools