This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


5j6u

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Current revision (10:11, 14 June 2023) (edit) (undo)
 
(4 intermediate revisions not shown.)
Line 1: Line 1:
-
'''Unreleased structure'''
 
-
The entry 5j6u is ON HOLD until Paper Publication
+
==DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium==
 +
<StructureSection load='5j6u' size='340' side='right'caption='[[5j6u]]' scene=''>
 +
== Structural highlights ==
 +
<table><tr><td colspan='2'>[[5j6u]] is a 1 chain structure with sequence from [https://en.wikipedia.org/wiki/Synthetic_construct Synthetic construct]. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5J6U OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=5J6U FirstGlance]. <br>
 +
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=5j6u FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5j6u OCA], [https://pdbe.org/5j6u PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=5j6u RCSB], [https://www.ebi.ac.uk/pdbsum/5j6u PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=5j6u ProSAT]</span></td></tr>
 +
</table>
 +
<div style="background-color:#fffaf0;">
 +
== Publication Abstract from PubMed ==
 +
The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications.
-
Authors: Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M.
+
Encoding canonical DNA quadruplex structure.,Dvorkin SA, Karsisiotis AI, Webba da Silva M Sci Adv. 2018 Aug 31;4(8):eaat3007. doi: 10.1126/sciadv.aat3007. eCollection 2018, Aug. PMID:30182059<ref>PMID:30182059</ref>
-
Description: DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium
+
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
-
[[Category: Unreleased Structures]]
+
</div>
-
[[Category: Dvorkin, S.A]]
+
<div class="pdbe-citations 5j6u" style="background-color:#fffaf0;"></div>
-
[[Category: Karsisiotis, A.I]]
+
== References ==
-
[[Category: Webba Da Silva, M]]
+
<references/>
 +
__TOC__
 +
</StructureSection>
 +
[[Category: Large Structures]]
 +
[[Category: Synthetic construct]]
 +
[[Category: Dvorkin SA]]
 +
[[Category: Karsisiotis AI]]
 +
[[Category: Webba da Silva M]]

Current revision

DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium

PDB ID 5j6u

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools