This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


2m6w

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Current revision (06:01, 15 May 2024) (edit) (undo)
 
(4 intermediate revisions not shown.)
Line 1: Line 1:
==Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions==
==Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions==
-
<StructureSection load='2m6w' size='340' side='right' caption='[[2m6w]], [[NMR_Ensembles_of_Models | 8 NMR models]]' scene=''>
+
<StructureSection load='2m6w' size='340' side='right'caption='[[2m6w]]' scene=''>
== Structural highlights ==
== Structural highlights ==
-
<table><tr><td colspan='2'>[[2m6w]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M6W OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2M6W FirstGlance]. <br>
+
<table><tr><td colspan='2'>[[2m6w]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M6W OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=2M6W FirstGlance]. <br>
-
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2m6w FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m6w OCA], [http://pdbe.org/2m6w PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=2m6w RCSB], [http://www.ebi.ac.uk/pdbsum/2m6w PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=2m6w ProSAT]</span></td></tr>
+
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">Solution NMR</td></tr>
 +
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=2m6w FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m6w OCA], [https://pdbe.org/2m6w PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=2m6w RCSB], [https://www.ebi.ac.uk/pdbsum/2m6w PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=2m6w ProSAT]</span></td></tr>
</table>
</table>
 +
<div style="background-color:#fffaf0;">
 +
== Publication Abstract from PubMed ==
 +
The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications.
 +
 +
Encoding canonical DNA quadruplex structure.,Dvorkin SA, Karsisiotis AI, Webba da Silva M Sci Adv. 2018 Aug 31;4(8):eaat3007. doi: 10.1126/sciadv.aat3007. eCollection 2018, Aug. PMID:30182059<ref>PMID:30182059</ref>
 +
 +
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
 +
</div>
 +
<div class="pdbe-citations 2m6w" style="background-color:#fffaf0;"></div>
 +
== References ==
 +
<references/>
__TOC__
__TOC__
</StructureSection>
</StructureSection>
-
[[Category: Karsisiotis, A I]]
+
[[Category: Large Structures]]
-
[[Category: Silva, M Webba da]]
+
[[Category: Karsisiotis AI]]
-
[[Category: Dna]]
+
[[Category: Webba da Silva M]]
-
[[Category: Folding topology]]
+
-
[[Category: G-quadruplex]]
+

Current revision

Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions

PDB ID 2m6w

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools