This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


2m90

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Current revision (06:02, 15 May 2024) (edit) (undo)
 
(4 intermediate revisions not shown.)
Line 1: Line 1:
==Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] quadruplex-duplex hybrid==
==Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] quadruplex-duplex hybrid==
-
<StructureSection load='2m90' size='340' side='right' caption='[[2m90]], [[NMR_Ensembles_of_Models | 10 NMR models]]' scene=''>
+
<StructureSection load='2m90' size='340' side='right'caption='[[2m90]]' scene=''>
== Structural highlights ==
== Structural highlights ==
-
<table><tr><td colspan='2'>[[2m90]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M90 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2M90 FirstGlance]. <br>
+
<table><tr><td colspan='2'>[[2m90]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M90 OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=2M90 FirstGlance]. <br>
-
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[2m8y|2m8y]], [[2m8z|2m8z]], [[2m91|2m91]], [[2m92|2m92]], [[2m93|2m93]]</td></tr>
+
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">Solution NMR</td></tr>
-
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2m90 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m90 OCA], [http://pdbe.org/2m90 PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=2m90 RCSB], [http://www.ebi.ac.uk/pdbsum/2m90 PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=2m90 ProSAT]</span></td></tr>
+
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=2m90 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m90 OCA], [https://pdbe.org/2m90 PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=2m90 RCSB], [https://www.ebi.ac.uk/pdbsum/2m90 PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=2m90 ProSAT]</span></td></tr>
</table>
</table>
<div style="background-color:#fffaf0;">
<div style="background-color:#fffaf0;">
Line 20: Line 20:
__TOC__
__TOC__
</StructureSection>
</StructureSection>
-
[[Category: Lim, K W]]
+
[[Category: Large Structures]]
-
[[Category: Phan, A T]]
+
[[Category: Lim KW]]
-
[[Category: Dna]]
+
[[Category: Phan AT]]
-
[[Category: Duplex]]
+
-
[[Category: Quadruplex]]
+
-
[[Category: Quadruplex-duplex hybrid]]
+

Current revision

Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] quadruplex-duplex hybrid

PDB ID 2m90

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools