This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


4h29

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Current revision (11:35, 1 March 2024) (edit) (undo)
 
(One intermediate revision not shown.)
Line 3: Line 3:
<StructureSection load='4h29' size='340' side='right'caption='[[4h29]], [[Resolution|resolution]] 1.99&Aring;' scene=''>
<StructureSection load='4h29' size='340' side='right'caption='[[4h29]], [[Resolution|resolution]] 1.99&Aring;' scene=''>
== Structural highlights ==
== Structural highlights ==
-
<table><tr><td colspan='2'>[[4h29]] is a 2 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4H29 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=4H29 FirstGlance]. <br>
+
<table><tr><td colspan='2'>[[4h29]] is a 2 chain structure with sequence from [https://en.wikipedia.org/wiki/Homo_sapiens Homo sapiens]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4H29 OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=4H29 FirstGlance]. <br>
-
</td></tr><tr id='ligand'><td class="sblockLbl"><b>[[Ligand|Ligands:]]</b></td><td class="sblockDat"><scene name='pdbligand=K:POTASSIUM+ION'>K</scene></td></tr>
+
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">X-ray diffraction, [[Resolution|Resolution]] 1.991&#8491;</td></tr>
-
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=4h29 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4h29 OCA], [http://pdbe.org/4h29 PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=4h29 RCSB], [http://www.ebi.ac.uk/pdbsum/4h29 PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=4h29 ProSAT]</span></td></tr>
+
<tr id='ligand'><td class="sblockLbl"><b>[[Ligand|Ligands:]]</b></td><td class="sblockDat" id="ligandDat"><scene name='pdbligand=K:POTASSIUM+ION'>K</scene></td></tr>
 +
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=4h29 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4h29 OCA], [https://pdbe.org/4h29 PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=4h29 RCSB], [https://www.ebi.ac.uk/pdbsum/4h29 PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=4h29 ProSAT]</span></td></tr>
</table>
</table>
-
<div style="background-color:#fffaf0;">
 
-
== Publication Abstract from PubMed ==
 
-
The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive G-quartets and an uninterrupted run of six potassium ions in the central channel of the quadruplex. Analogy with previously reported promoter quadruplexes had initially suggested that in common with these a monomeric quadruplex was to be expected. The structure has a distorted G.C.G.C base quartet at one end and four flipped-out adenosine nucleosides at the other. The only loops in the structure are formed by the cytosine and by the three adenosines within the sequence, with all of the guanosines participating in G-quartet formation. Solution UV and circular dichroism data are in accord with a stable quadruple arrangement being formed. 1D NMR data, together with gel electrophoresis measurements, are consistent with a dimer being the dominant species in potassium solution. A single-chain intramolecular quadruplex has been straightforwardly constructed using molecular modeling, by means of a six-nucleotide sequence joining 3' and 5' ends of each strand in the dimer. A human genomic database search has revealed a number of sequences containing eight or more consecutive short G-tracts, suggesting that such intramolecular quadruplexes could be formed within the human genome.
 
- 
-
Crystal Structure of a Promoter Sequence in the B-raf Gene Reveals an Intertwined Dimer Quadruplex.,Wei D, Todd AK, Zloh M, Gunaratnam M, Parkinson GN, Neidle S J Am Chem Soc. 2013 Dec 26;135(51):19319-29. doi: 10.1021/ja4101358. Epub 2013, Dec 11. PMID:24295054<ref>PMID:24295054</ref>
 
- 
-
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
 
-
</div>
 
-
<div class="pdbe-citations 4h29" style="background-color:#fffaf0;"></div>
 
-
== References ==
 
-
<references/>
 
__TOC__
__TOC__
</StructureSection>
</StructureSection>
 +
[[Category: Homo sapiens]]
[[Category: Large Structures]]
[[Category: Large Structures]]
-
[[Category: Neidle, S]]
+
[[Category: Neidle S]]
-
[[Category: Parkinson, G]]
+
[[Category: Parkinson G]]
-
[[Category: Wei, D]]
+
[[Category: Wei D]]
-
[[Category: B-raf quadruplex dna]]
+
-
[[Category: Dna]]
+

Current revision

B-raf dimer DNA quadruplex

PDB ID 4h29

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools