This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.
Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.
4ihv
From Proteopedia
(Difference between revisions)
| Line 4: | Line 4: | ||
== Structural highlights == | == Structural highlights == | ||
<table><tr><td colspan='2'>[[4ihv]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Escherichia_coli_K-12 Escherichia coli K-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=4IHV FirstGlance]. <br> | <table><tr><td colspan='2'>[[4ihv]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Escherichia_coli_K-12 Escherichia coli K-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=4IHV FirstGlance]. <br> | ||
| - | </td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=4ihv FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4ihv OCA], [https://pdbe.org/4ihv PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=4ihv RCSB], [https://www.ebi.ac.uk/pdbsum/4ihv PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=4ihv ProSAT]</span></td></tr> | + | </td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">X-ray diffraction, [[Resolution|Resolution]] 2.716Å</td></tr> |
| + | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=4ihv FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4ihv OCA], [https://pdbe.org/4ihv PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=4ihv RCSB], [https://www.ebi.ac.uk/pdbsum/4ihv PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=4ihv ProSAT]</span></td></tr> | ||
</table> | </table> | ||
<div style="background-color:#fffaf0;"> | <div style="background-color:#fffaf0;"> | ||
Current revision
Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
| |||||||||||
