This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


1r7z

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Current revision (09:20, 6 December 2023) (edit) (undo)
 
(9 intermediate revisions not shown.)
Line 1: Line 1:
-
[[Image:1r7z.gif|left|200px]]
 
-
<!--
+
==NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE==
-
The line below this paragraph, containing "STRUCTURE_1r7z", creates the "Structure Box" on the page.
+
<StructureSection load='1r7z' size='340' side='right'caption='[[1r7z]]' scene=''>
-
You may change the PDB parameter (which sets the PDB file loaded into the applet)
+
== Structural highlights ==
-
or the SCENE parameter (which sets the initial scene displayed when the page is loaded),
+
<table><tr><td colspan='2'>[[1r7z]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1R7Z OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=1R7Z FirstGlance]. <br>
-
or leave the SCENE parameter empty for the default display.
+
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">Solution NMR</td></tr>
-
-->
+
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=1r7z FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1r7z OCA], [https://pdbe.org/1r7z PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=1r7z RCSB], [https://www.ebi.ac.uk/pdbsum/1r7z PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=1r7z ProSAT]</span></td></tr>
-
{{STRUCTURE_1r7z| PDB=1r7z | SCENE= }}
+
</table>
-
 
+
<div style="background-color:#fffaf0;">
-
'''NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE'''
+
== Publication Abstract from PubMed ==
-
 
+
-
 
+
-
==Overview==
+
The 5'-untranslated region of positive-strand RNA viruses harbors many cis-acting RNA structural elements that are important for various viral processes such as replication, translation, and packaging of new virions. Among these is loop B RNA of the stem-loop IV domain within the internal ribosomal entry site (IRES) of enteroviruses, including Poliovirus type 1 (PV1). Studies on PV1 have shown that specific recognition of loop B by the first KH (hnRNP K homology) domain of cellular poly(rC)-binding protein 2 (PCBP2) is essential for efficient translation of the viral mRNA. Here we report the NMR solution structures of two representative sequence variants of enteroviral loop B RNA. The two RNA variants differ at only one position (C vs U) within a six-nucleotide asymmetric internal loop sequence that is the binding site for the PCBP2 KH1 domain. Surprisingly, the two RNAs are drastically different in the overall shape and local dynamics of the bulge region. The RNA with the 5'-AUCCCU bulge sequence adopts an overall L shape. Its bulge nucleotides, especially the last four, are highly flexible and not very well defined by NMR. The RNA with the 5'-AUUCCU bulge sequence adopts an overall U shape, and its bulge sequence exhibits only limited flexibility. A detailed analysis of the two RNA structures and their dynamic properties, as well as available sequence data and known KH domain-RNA complex structures, not only provides insights into how loop B RNA might be recognized by the PCBP2 KH1 domain but also suggests a possible correlation between structural flexibility and pre-existing structural features for protein recognition.
The 5'-untranslated region of positive-strand RNA viruses harbors many cis-acting RNA structural elements that are important for various viral processes such as replication, translation, and packaging of new virions. Among these is loop B RNA of the stem-loop IV domain within the internal ribosomal entry site (IRES) of enteroviruses, including Poliovirus type 1 (PV1). Studies on PV1 have shown that specific recognition of loop B by the first KH (hnRNP K homology) domain of cellular poly(rC)-binding protein 2 (PCBP2) is essential for efficient translation of the viral mRNA. Here we report the NMR solution structures of two representative sequence variants of enteroviral loop B RNA. The two RNA variants differ at only one position (C vs U) within a six-nucleotide asymmetric internal loop sequence that is the binding site for the PCBP2 KH1 domain. Surprisingly, the two RNAs are drastically different in the overall shape and local dynamics of the bulge region. The RNA with the 5'-AUCCCU bulge sequence adopts an overall L shape. Its bulge nucleotides, especially the last four, are highly flexible and not very well defined by NMR. The RNA with the 5'-AUUCCU bulge sequence adopts an overall U shape, and its bulge sequence exhibits only limited flexibility. A detailed analysis of the two RNA structures and their dynamic properties, as well as available sequence data and known KH domain-RNA complex structures, not only provides insights into how loop B RNA might be recognized by the PCBP2 KH1 domain but also suggests a possible correlation between structural flexibility and pre-existing structural features for protein recognition.
-
==About this Structure==
+
NMR structures of loop B RNAs from the stem-loop IV domain of the enterovirus internal ribosome entry site: a single C to U substitution drastically changes the shape and flexibility of RNA.,Du Z, Ulyanov NB, Yu J, Andino R, James TL Biochemistry. 2004 May 18;43(19):5757-71. PMID:15134450<ref>PMID:15134450</ref>
-
Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1R7Z OCA].
+
-
==Reference==
+
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
-
NMR structures of loop B RNAs from the stem-loop IV domain of the enterovirus internal ribosome entry site: a single C to U substitution drastically changes the shape and flexibility of RNA., Du Z, Ulyanov NB, Yu J, Andino R, James TL, Biochemistry. 2004 May 18;43(19):5757-71. PMID:[http://www.ncbi.nlm.nih.gov/pubmed/15134450 15134450]
+
</div>
-
[[Category: Du, Z.]]
+
<div class="pdbe-citations 1r7z" style="background-color:#fffaf0;"></div>
-
[[Category: James, T L.]]
+
== References ==
-
[[Category: Ulyanov, N B.]]
+
<references/>
-
[[Category: Yu, J.]]
+
__TOC__
-
[[Category: Guga tetraloop]]
+
</StructureSection>
-
[[Category: Six-nucleotide bulge]]
+
[[Category: Large Structures]]
-
[[Category: Stem-and-loop structure]]
+
[[Category: Du Z]]
-
''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Sat May 3 07:11:49 2008''
+
[[Category: James TL]]
 +
[[Category: Ulyanov NB]]
 +
[[Category: Yu J]]

Current revision

NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE

PDB ID 1r7z

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools