We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

9pz7

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
(New page: '''Unreleased structure''' The entry 9pz7 is ON HOLD Authors: Werther, R., Stoddard, B.L. Description: Engineered variant of I-OnuI meganuclease to target DNA sequence TTTCCACTTATTCACT...)
Current revision (04:17, 14 September 2025) (edit) (undo)
 
(2 intermediate revisions not shown.)
Line 1: Line 1:
-
'''Unreleased structure'''
 
-
The entry 9pz7 is ON HOLD
+
==One of a series of engineered variants of I-OnuI meganuclease targeting altered DNA target sequence==
-
 
+
<StructureSection load='9pz7' size='340' side='right'caption='[[9pz7]], [[Resolution|resolution]] 2.50&Aring;' scene=''>
-
Authors: Werther, R., Stoddard, B.L.
+
== Structural highlights ==
-
 
+
<table><tr><td colspan='2'>[[9pz7]] is a 3 chain structure with sequence from [https://en.wikipedia.org/wiki/Synthetic_construct Synthetic construct]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=9PZ7 OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=9PZ7 FirstGlance]. <br>
-
Description: Engineered variant of I-OnuI meganuclease to target DNA sequence TTTCCACTTATTCACTATTTTA
+
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">X-ray diffraction, [[Resolution|Resolution]] 2.504&#8491;</td></tr>
-
[[Category: Unreleased Structures]]
+
<tr id='ligand'><td class="sblockLbl"><b>[[Ligand|Ligands:]]</b></td><td class="sblockDat" id="ligandDat"><scene name='pdbligand=CA:CALCIUM+ION'>CA</scene>, <scene name='pdbligand=CL:CHLORIDE+ION'>CL</scene>, <scene name='pdbligand=GOL:GLYCEROL'>GOL</scene>, <scene name='pdbligand=SO4:SULFATE+ION'>SO4</scene></td></tr>
-
[[Category: Stoddard, B.L]]
+
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=9pz7 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=9pz7 OCA], [https://pdbe.org/9pz7 PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=9pz7 RCSB], [https://www.ebi.ac.uk/pdbsum/9pz7 PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=9pz7 ProSAT]</span></td></tr>
-
[[Category: Werther, R]]
+
</table>
 +
__TOC__
 +
</StructureSection>
 +
[[Category: Large Structures]]
 +
[[Category: Synthetic construct]]
 +
[[Category: Stoddard BL]]
 +
[[Category: Werther R]]

Current revision

One of a series of engineered variants of I-OnuI meganuclease targeting altered DNA target sequence

PDB ID 9pz7

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools