9yzk

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
(New page: '''Unreleased structure''' The entry 9yzk is ON HOLD Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. Description: Isoreticular co-crystal 1 with symmetrical expanded d...)
Current revision (17:55, 4 December 2025) (edit) (undo)
 
(One intermediate revision not shown.)
Line 1: Line 1:
'''Unreleased structure'''
'''Unreleased structure'''
-
The entry 9yzk is ON HOLD
+
The entry 9yzk is ON HOLD until Paper Publication
Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Line 7: Line 7:
Description: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
Description: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
[[Category: Unreleased Structures]]
[[Category: Unreleased Structures]]
 +
[[Category: Slaughter, C.K]]
 +
[[Category: Shields, E.T]]
[[Category: Snow, C.D]]
[[Category: Snow, C.D]]
[[Category: Magna, E.N]]
[[Category: Magna, E.N]]
-
[[Category: Shields, E.T]]
 
-
[[Category: Slaughter, C.K]]
 

Current revision

Unreleased structure

The entry 9yzk is ON HOLD until Paper Publication

Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.

Description: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools