This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


1jua

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Current revision (18:44, 29 November 2023) (edit) (undo)
 
(9 intermediate revisions not shown.)
Line 1: Line 1:
-
{{Seed}}
 
-
[[Image:1jua.png|left|200px]]
 
-
<!--
+
==Solution Structure of the Deoxyribose HIV-1Lai Initiation Sequence Stable Dimer==
-
The line below this paragraph, containing "STRUCTURE_1jua", creates the "Structure Box" on the page.
+
<StructureSection load='1jua' size='340' side='right'caption='[[1jua]]' scene=''>
-
You may change the PDB parameter (which sets the PDB file loaded into the applet)
+
== Structural highlights ==
-
or the SCENE parameter (which sets the initial scene displayed when the page is loaded),
+
<table><tr><td colspan='2'>[[1jua]] is a 2 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1JUA OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=1JUA FirstGlance]. <br>
-
or leave the SCENE parameter empty for the default display.
+
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">Solution NMR</td></tr>
-
-->
+
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=1jua FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1jua OCA], [https://pdbe.org/1jua PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=1jua RCSB], [https://www.ebi.ac.uk/pdbsum/1jua PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=1jua ProSAT]</span></td></tr>
-
{{STRUCTURE_1jua| PDB=1jua | SCENE= }}
+
</table>
 +
<div style="background-color:#fffaf0;">
 +
== Publication Abstract from PubMed ==
 +
The deoxyoligoribonucleotide d(CTTGCTGAAGCGCGCACGGCAAG) (dSL1) corresponding to the reverse transcripted sequence of the dimerization initiation site SL1 of HIV- 1(Lai) RNA was synthesized using phosphoramidite chemistry. Like its oligoribonucleotide counterpart, dSL1 dimerized spontaneously in solution. Here we report the first NMR solution structure of a kissing complex formed with two DNA strands. The melting point of the DNA dimer (35 degrees C) was found slightly higher than the one of the corresponding RNA dimer (32 degrees C). Despite this only slight difference in melting point, several structural differences were observed between the ribo- and the deoxyribo- dimers. The solution structure of the deoxy- dimer was a symmetric homodimer with a loop-loop interaction stabilized by four central G-C base-pairs, a head to tail A-A base-pair arrangement between the A8 residues of the two strands and a stacking of A9 with C15. As a consequence, G10 was not paired and occupied a position outside the stem and the loop. Each stem was formed by seven base-pairs whose axis made an angle of about 100 degree with the plane of the loops. The distortion of the helix at the junction of the stem and of the loop induced a fold up of the A8pA9 step with a phosphate-phosphate distance lowered to 4.5 A. The plane of the non-canonical A-A base-pair was oriented perpendicularly to the axis of the stems. The four central base-pairs formed an open fan-shaped motif with an angle of 20 degrees between the bases and each of them was oriented perpendicularly to the A8-A8 plane. The deviation of the computed chemical shifts and the experimental ones for the aromatic proton was always less than 0.25ppm for each of the 16 converged solution structures and their average less than 0.1ppm.
-
===Solution Structure of the Deoxyribose HIV-1Lai Initiation Sequence Stable Dimer===
+
A new peculiar DNA structure: NMR solution structure of a DNA kissing complex.,Barbault F, Huynh-Dinh T, Paoletti J, Lanceloti G J Biomol Struct Dyn. 2002 Feb;19(4):649-58. PMID:11843626<ref>PMID:11843626</ref>
-
 
+
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
-
<!--
+
</div>
-
The line below this paragraph, {{ABSTRACT_PUBMED_11843626}}, adds the Publication Abstract to the page
+
<div class="pdbe-citations 1jua" style="background-color:#fffaf0;"></div>
-
(as it appears on PubMed at http://www.pubmed.gov), where 11843626 is the PubMed ID number.
+
== References ==
-
-->
+
<references/>
-
{{ABSTRACT_PUBMED_11843626}}
+
__TOC__
-
 
+
</StructureSection>
-
==About this Structure==
+
[[Category: Large Structures]]
-
Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1JUA OCA].
+
[[Category: Barbault F]]
-
 
+
[[Category: Huynh-Dinh T]]
-
==Reference==
+
[[Category: Lancelot G]]
-
A new peculiar DNA structure: NMR solution structure of a DNA kissing complex., Barbault F, Huynh-Dinh T, Paoletti J, Lanceloti G, J Biomol Struct Dyn. 2002 Feb;19(4):649-58. PMID:[http://www.ncbi.nlm.nih.gov/pubmed/11843626 11843626]
+
[[Category: Paoletti J]]
-
[[Category: Barbault, F.]]
+
-
[[Category: Huynh-Dinh, T.]]
+
-
[[Category: Lancelot, G.]]
+
-
[[Category: Paoletti, J.]]
+
-
[[Category: Dna]]
+
-
[[Category: Hiv]]
+
-
[[Category: Kissing-complex]]
+
-
[[Category: Loop-loop dimer]]
+
-
[[Category: Sl1]]
+
-
[[Category: Stable dimer]]
+
-
 
+
-
''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Tue Jul 1 20:53:00 2008''
+

Current revision

Solution Structure of the Deoxyribose HIV-1Lai Initiation Sequence Stable Dimer

PDB ID 1jua

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools