This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.
Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.
1qwb
From Proteopedia
(Difference between revisions)
| (9 intermediate revisions not shown.) | |||
| Line 1: | Line 1: | ||
| - | {{Seed}} | ||
| - | [[Image:1qwb.png|left|200px]] | ||
| - | + | ==NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12== | |
| - | + | <StructureSection load='1qwb' size='340' side='right'caption='[[1qwb]]' scene=''> | |
| - | + | == Structural highlights == | |
| - | + | <table><tr><td colspan='2'>[[1qwb]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=1QWB FirstGlance]. <br> | |
| - | + | </td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">Solution NMR</td></tr> | |
| - | + | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=1qwb FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwb OCA], [https://pdbe.org/1qwb PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=1qwb RCSB], [https://www.ebi.ac.uk/pdbsum/1qwb PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=1qwb ProSAT]</span></td></tr> | |
| - | + | </table> | |
| - | + | __TOC__ | |
| - | + | </StructureSection> | |
| - | + | [[Category: Large Structures]] | |
| - | + | [[Category: Feigon J]] | |
| - | < | + | [[Category: Finger LD]] |
| - | + | [[Category: Johansson C]] | |
| - | + | [[Category: Trantirek L]] | |
| - | + | ||
| - | + | ||
| - | + | ||
| - | == | + | |
| - | Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA]. | + | |
| - | + | ||
| - | == | + | |
| - | Solution | + | |
| - | [ | + | |
| - | + | ||
| - | [ | + | |
| - | [ | + | |
| - | [[Category: | + | |
| - | [[Category: | + | |
| - | [[Category: | + | |
| - | [[Category: | + | |
| - | + | ||
| - | + | ||
Current revision
NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12
| |||||||||||
