This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.
Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.
1qwa
From Proteopedia
(Difference between revisions)
| (9 intermediate revisions not shown.) | |||
| Line 1: | Line 1: | ||
| - | {{Seed}} | ||
| - | [[Image:1qwa.png|left|200px]] | ||
| - | + | ==NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.== | |
| - | + | <StructureSection load='1qwa' size='340' side='right'caption='[[1qwa]]' scene=''> | |
| - | + | == Structural highlights == | |
| - | + | <table><tr><td colspan='2'>[[1qwa]] is a 1 chain structure with sequence from [https://en.wikipedia.org/wiki/Mus_musculus Mus musculus]. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWA OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=1QWA FirstGlance]. <br> | |
| - | + | </td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">Solution NMR</td></tr> | |
| - | + | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=1qwa FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwa OCA], [https://pdbe.org/1qwa PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=1qwa RCSB], [https://www.ebi.ac.uk/pdbsum/1qwa PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=1qwa ProSAT]</span></td></tr> | |
| - | + | </table> | |
| - | + | __TOC__ | |
| - | + | </StructureSection> | |
| - | + | [[Category: Large Structures]] | |
| - | + | [[Category: Mus musculus]] | |
| - | < | + | [[Category: Feigon J]] |
| - | + | [[Category: Finger LD]] | |
| - | + | [[Category: Johansson C]] | |
| - | + | [[Category: Trantirek L]] | |
| - | + | ||
| - | + | ||
| - | == | + | |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | [[ | + | |
| - | [ | + | |
| - | [ | + | |
| - | [ | + | |
| - | + | ||
| - | [ | + | |
| - | [[Category: | + | |
| - | [[Category: | + | |
| - | [[Category: | + | |
| - | [[Category: | + | |
| - | [[Category: | + | |
| - | [[Category: | + | |
| - | + | ||
| - | + | ||
Current revision
NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
| |||||||||||
