This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


1qwa

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Current revision (06:34, 1 May 2024) (edit) (undo)
 
(9 intermediate revisions not shown.)
Line 1: Line 1:
-
{{Seed}}
 
-
[[Image:1qwa.png|left|200px]]
 
-
<!--
+
==NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.==
-
The line below this paragraph, containing "STRUCTURE_1qwa", creates the "Structure Box" on the page.
+
<StructureSection load='1qwa' size='340' side='right'caption='[[1qwa]]' scene=''>
-
You may change the PDB parameter (which sets the PDB file loaded into the applet)
+
== Structural highlights ==
-
or the SCENE parameter (which sets the initial scene displayed when the page is loaded),
+
<table><tr><td colspan='2'>[[1qwa]] is a 1 chain structure with sequence from [https://en.wikipedia.org/wiki/Mus_musculus Mus musculus]. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWA OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=1QWA FirstGlance]. <br>
-
or leave the SCENE parameter empty for the default display.
+
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">Solution NMR</td></tr>
-
-->
+
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=1qwa FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwa OCA], [https://pdbe.org/1qwa PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=1qwa RCSB], [https://www.ebi.ac.uk/pdbsum/1qwa PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=1qwa ProSAT]</span></td></tr>
-
{{STRUCTURE_1qwa| PDB=1qwa | SCENE= }}
+
</table>
-
 
+
__TOC__
-
===NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.===
+
</StructureSection>
-
 
+
[[Category: Large Structures]]
-
 
+
[[Category: Mus musculus]]
-
<!--
+
[[Category: Feigon J]]
-
The line below this paragraph, {{ABSTRACT_PUBMED_14602904}}, adds the Publication Abstract to the page
+
[[Category: Finger LD]]
-
(as it appears on PubMed at http://www.pubmed.gov), where 14602904 is the PubMed ID number.
+
[[Category: Johansson C]]
-
-->
+
[[Category: Trantirek L]]
-
{{ABSTRACT_PUBMED_14602904}}
+
-
 
+
-
==About this Structure==
+
-
1QWA is a [[Single protein]] structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWA OCA].
+
-
 
+
-
==Reference==
+
-
Solution structures of stem-loop RNAs that bind to the two N-terminal RNA-binding domains of nucleolin., Finger LD, Trantirek L, Johansson C, Feigon J, Nucleic Acids Res. 2003 Nov 15;31(22):6461-72. PMID:[http://www.ncbi.nlm.nih.gov/pubmed/14602904 14602904]
+
-
[[Category: Single protein]]
+
-
[[Category: Feigon, J.]]
+
-
[[Category: Finger, L D.]]
+
-
[[Category: Johansson, C.]]
+
-
[[Category: Trantirek, L.]]
+
-
[[Category: A-form helix]]
+
-
[[Category: Bulged nucleotide]]
+
-
[[Category: Hairpin]]
+
-
[[Category: Tetraloop]]
+
-
[[Category: Uncg]]
+
-
[[Category: Uucg]]
+
-
[[Category: Ynmg]]
+
-
 
+
-
''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Tue Jul 29 08:13:30 2008''
+

Current revision

NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.

PDB ID 1qwa

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools