This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.

Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


1qwa

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
m (Protected "1qwa" [edit=sysop:move=sysop])

Revision as of 06:35, 1 February 2012

Image:1qwa.png

Template:STRUCTURE 1qwa

NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.

Template:ABSTRACT PUBMED 14602904

About this Structure

1qwa is a 1 chain structure. Full experimental information is available from OCA.

Reference

  • Finger LD, Trantirek L, Johansson C, Feigon J. Solution structures of stem-loop RNAs that bind to the two N-terminal RNA-binding domains of nucleolin. Nucleic Acids Res. 2003 Nov 15;31(22):6461-72. PMID:14602904

Proteopedia Page Contributors and Editors (what is this?)

OCA

Retrieved from "http://52.214.119.220/wiki/index.php/1qwa"
Personal tools