1qwa
From Proteopedia
(Difference between revisions)
m (Protected "1qwa" [edit=sysop:move=sysop]) |
|||
| Line 1: | Line 1: | ||
| - | [[Image:1qwa.png|left|200px]] | ||
| - | |||
| - | <!-- | ||
| - | The line below this paragraph, containing "STRUCTURE_1qwa", creates the "Structure Box" on the page. | ||
| - | You may change the PDB parameter (which sets the PDB file loaded into the applet) | ||
| - | or the SCENE parameter (which sets the initial scene displayed when the page is loaded), | ||
| - | or leave the SCENE parameter empty for the default display. | ||
| - | --> | ||
{{STRUCTURE_1qwa| PDB=1qwa | SCENE= }} | {{STRUCTURE_1qwa| PDB=1qwa | SCENE= }} | ||
| - | |||
===NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.=== | ===NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.=== | ||
| - | |||
| - | |||
| - | <!-- | ||
| - | The line below this paragraph, {{ABSTRACT_PUBMED_14602904}}, adds the Publication Abstract to the page | ||
| - | (as it appears on PubMed at http://www.pubmed.gov), where 14602904 is the PubMed ID number. | ||
| - | --> | ||
{{ABSTRACT_PUBMED_14602904}} | {{ABSTRACT_PUBMED_14602904}} | ||
| Line 22: | Line 7: | ||
==Reference== | ==Reference== | ||
| - | <ref group="xtra">PMID:014602904</ref><references group="xtra"/> | + | <ref group="xtra">PMID:014602904</ref><references group="xtra"/><references/> |
[[Category: Feigon, J.]] | [[Category: Feigon, J.]] | ||
[[Category: Finger, L D.]] | [[Category: Finger, L D.]] | ||
Revision as of 10:47, 16 April 2014
NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
Template:ABSTRACT PUBMED 14602904
About this Structure
1qwa is a 1 chain structure. Full experimental information is available from OCA.
Reference
- Finger LD, Trantirek L, Johansson C, Feigon J. Solution structures of stem-loop RNAs that bind to the two N-terminal RNA-binding domains of nucleolin. Nucleic Acids Res. 2003 Nov 15;31(22):6461-72. PMID:14602904
Categories: Feigon, J. | Finger, L D. | Johansson, C. | Trantirek, L. | A-form helix | Bulged nucleotide | Hairpin | Rna | Tetraloop | Uncg | Uucg | Ynmg
