We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

1jua

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
m (Protected "1jua" [edit=sysop:move=sysop])
Line 1: Line 1:
-
[[Image:1jua.png|left|200px]]
+
==Solution Structure of the Deoxyribose HIV-1Lai Initiation Sequence Stable Dimer==
 +
<StructureSection load='1jua' size='340' side='right' caption='[[1jua]], [[NMR_Ensembles_of_Models | 13 NMR models]]' scene=''>
 +
== Structural highlights ==
 +
<table><tr><td colspan='2'>[[1jua]] is a 2 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1JUA OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1JUA FirstGlance]. <br>
 +
</td></tr><tr><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[1jtj|1jtj]], [[1ju0|1ju0]], [[1ju1|1ju1]]</td></tr>
 +
<tr><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1jua FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1jua OCA], [http://www.rcsb.org/pdb/explore.do?structureId=1jua RCSB], [http://www.ebi.ac.uk/pdbsum/1jua PDBsum]</span></td></tr>
 +
<table>
 +
<div style="background-color:#fffaf0;">
 +
== Publication Abstract from PubMed ==
 +
The deoxyoligoribonucleotide d(CTTGCTGAAGCGCGCACGGCAAG) (dSL1) corresponding to the reverse transcripted sequence of the dimerization initiation site SL1 of HIV- 1(Lai) RNA was synthesized using phosphoramidite chemistry. Like its oligoribonucleotide counterpart, dSL1 dimerized spontaneously in solution. Here we report the first NMR solution structure of a kissing complex formed with two DNA strands. The melting point of the DNA dimer (35 degrees C) was found slightly higher than the one of the corresponding RNA dimer (32 degrees C). Despite this only slight difference in melting point, several structural differences were observed between the ribo- and the deoxyribo- dimers. The solution structure of the deoxy- dimer was a symmetric homodimer with a loop-loop interaction stabilized by four central G-C base-pairs, a head to tail A-A base-pair arrangement between the A8 residues of the two strands and a stacking of A9 with C15. As a consequence, G10 was not paired and occupied a position outside the stem and the loop. Each stem was formed by seven base-pairs whose axis made an angle of about 100 degree with the plane of the loops. The distortion of the helix at the junction of the stem and of the loop induced a fold up of the A8pA9 step with a phosphate-phosphate distance lowered to 4.5 A. The plane of the non-canonical A-A base-pair was oriented perpendicularly to the axis of the stems. The four central base-pairs formed an open fan-shaped motif with an angle of 20 degrees between the bases and each of them was oriented perpendicularly to the A8-A8 plane. The deviation of the computed chemical shifts and the experimental ones for the aromatic proton was always less than 0.25ppm for each of the 16 converged solution structures and their average less than 0.1ppm.
-
{{STRUCTURE_1jua| PDB=1jua | SCENE= }}
+
A new peculiar DNA structure: NMR solution structure of a DNA kissing complex.,Barbault F, Huynh-Dinh T, Paoletti J, Lanceloti G J Biomol Struct Dyn. 2002 Feb;19(4):649-58. PMID:11843626<ref>PMID:11843626</ref>
-
===Solution Structure of the Deoxyribose HIV-1Lai Initiation Sequence Stable Dimer===
+
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
-
 
+
</div>
-
{{ABSTRACT_PUBMED_11843626}}
+
== References ==
-
 
+
<references/>
-
==About this Structure==
+
__TOC__
-
[[1jua]] is a 2 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1JUA OCA].
+
</StructureSection>
-
 
+
-
==Reference==
+
-
<ref group="xtra">PMID:011843626</ref><references group="xtra"/>
+
[[Category: Barbault, F.]]
[[Category: Barbault, F.]]
[[Category: Huynh-Dinh, T.]]
[[Category: Huynh-Dinh, T.]]

Revision as of 11:38, 28 September 2014

Solution Structure of the Deoxyribose HIV-1Lai Initiation Sequence Stable Dimer

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Views
Personal tools
Navigation
Toolbox