2m8z

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
-
'''Unreleased structure'''
+
{{STRUCTURE_2m8z| PDB=2m8z | SCENE= }}
 +
===Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid===
 +
{{ABSTRACT_PUBMED_23794476}}
-
The entry 2m8z is ON HOLD until Paper Publication
+
==About this Structure==
 +
[[2m8z]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M8Z OCA].
-
Authors: Lim, K.W., Phan, A.T.
+
==Reference==
-
 
+
<ref group="xtra">PMID:023794476</ref><references group="xtra"/><references/>
-
Description: Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid
+
[[Category: Lim, K W.]]
 +
[[Category: Phan, A T.]]
 +
[[Category: Dna]]
 +
[[Category: Duplex]]
 +
[[Category: Quadruplex]]
 +
[[Category: Quadruplex-duplex hybrid]]

Revision as of 15:38, 10 July 2013

Template:STRUCTURE 2m8z

Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid

Template:ABSTRACT PUBMED 23794476

About this Structure

2m8z is a 1 chain structure. Full experimental information is available from OCA.

Reference

  • Lim KW, Phan AT. Structural Basis of DNA Quadruplex-Duplex Junction Formation. Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476 doi:10.1002/anie.201302995

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools