This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


2m92

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
-
'''Unreleased structure'''
+
{{STRUCTURE_2m92| PDB=2m92 | SCENE= }}
 +
===Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex hybrid===
 +
{{ABSTRACT_PUBMED_23794476}}
-
The entry 2m92 is ON HOLD until Paper Publication
+
==About this Structure==
 +
[[2m92]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M92 OCA].
-
Authors: Lim, K.W., Phan, A.T.
+
==Reference==
-
 
+
<ref group="xtra">PMID:023794476</ref><references group="xtra"/><references/>
-
Description: Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex hybrid
+
[[Category: Lim, K W.]]
 +
[[Category: Phan, A T.]]
 +
[[Category: Dna]]
 +
[[Category: Duplex]]
 +
[[Category: Quadruplex]]
 +
[[Category: Quadruplex-duplex hybrid]]

Revision as of 15:42, 10 July 2013

Template:STRUCTURE 2m92

Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex hybrid

Template:ABSTRACT PUBMED 23794476

About this Structure

2m92 is a 1 chain structure. Full experimental information is available from OCA.

Reference

  • Lim KW, Phan AT. Structural Basis of DNA Quadruplex-Duplex Junction Formation. Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476 doi:10.1002/anie.201302995

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools