2m8z
From Proteopedia
(Difference between revisions)
Line 1: | Line 1: | ||
- | + | ==Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid== | |
- | + | <StructureSection load='2m8z' size='340' side='right' caption='[[2m8z]], [[NMR_Ensembles_of_Models | 10 NMR models]]' scene=''> | |
- | + | == Structural highlights == | |
+ | <table><tr><td colspan='2'>[[2m8z]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M8Z OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2M8Z FirstGlance]. <br> | ||
+ | </td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[2m8y|2m8y]], [[2m90|2m90]], [[2m91|2m91]], [[2m92|2m92]], [[2m93|2m93]]</td></tr> | ||
+ | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2m8z FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m8z OCA], [http://www.rcsb.org/pdb/explore.do?structureId=2m8z RCSB], [http://www.ebi.ac.uk/pdbsum/2m8z PDBsum]</span></td></tr> | ||
+ | </table> | ||
+ | <div style="background-color:#fffaf0;"> | ||
+ | == Publication Abstract from PubMed == | ||
+ | Coaxial and orthogonal orientations of the helices (left and right illustration, respectively) in a quadruplex-duplex junction were realized by incorporating a duplex hairpin across the diverse geometries of a quadruplex. The modularity of the approach was validated through the simultaneous attachment of multiple duplex stems onto a G-quadruplex scaffold to generate a G-junction. | ||
- | + | Structural Basis of DNA Quadruplex-Duplex Junction Formation.,Lim KW, Phan AT Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476<ref>PMID:23794476</ref> | |
- | + | ||
- | == | + | From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br> |
- | + | </div> | |
- | [[Category: Lim, K W | + | == References == |
- | [[Category: Phan, A T | + | <references/> |
+ | __TOC__ | ||
+ | </StructureSection> | ||
+ | [[Category: Lim, K W]] | ||
+ | [[Category: Phan, A T]] | ||
[[Category: Dna]] | [[Category: Dna]] | ||
[[Category: Duplex]] | [[Category: Duplex]] | ||
[[Category: Quadruplex]] | [[Category: Quadruplex]] | ||
[[Category: Quadruplex-duplex hybrid]] | [[Category: Quadruplex-duplex hybrid]] |
Revision as of 11:55, 18 December 2014
Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid
|